View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0628_low_16 (Length: 347)
Name: NF0628_low_16
Description: NF0628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0628_low_16 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 63 - 347
Target Start/End: Original strand, 48167482 - 48167766
Alignment:
| Q |
63 |
catcatcatatagagggttgtgttgtccatagagatatcaaggtaagtgtgatgaagttaatctggaatggattctgcacttaattgggaatgattagaa |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48167482 |
catcatcatatagagggttgtgttgtccatagagatatcaaggtaagtgtgatgaagttaatctggaatggattctgcacttaattgggaatgattagaa |
48167581 |
T |
|
| Q |
163 |
aatgttttcttaatgccttgtattgattttattgtttagcttacaaacattcttttgactgagaaatatgaagccaaactgtcggattttggattgtcaa |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48167582 |
aatgttttcttaatgccttgtattgattttattgtttagcttacaaacattcttttgactgagaaatatgaagccaaactgtcggattttggattgtcaa |
48167681 |
T |
|
| Q |
263 |
ggatgatgggcatggaagagagcaaggtttttactgatgttagaggaactataggttacatggatccagagtacatgagtaatgc |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48167682 |
ggatgatgggcatggaagagagcaaggtttttactgatgttagaggaactataggttacatggatccagagtacatgagtaatgc |
48167766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3387 times since January 2019
Visitors: 4034