View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0628_low_21 (Length: 314)
Name: NF0628_low_21
Description: NF0628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0628_low_21 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 23 - 314
Target Start/End: Original strand, 34451898 - 34452188
Alignment:
Q |
23 |
aacaatagttttgtagctttagtttgttgcattgcattgtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgt |
122 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34451898 |
aacaatagttctgtagctttagtttgttgcattgcatggtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgt |
34451997 |
T |
 |
Q |
123 |
catatgatgggaacagtccnnnnnnngcaacctacagtattaccctttcttctttaattagatctttcatcatcaattcacaaagatcaaacnnnnnnnn |
222 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
T |
34451998 |
catatgatgggaacagtccaacaaaagcaacctacagtattaccttttcttctttaatcagatctttcatcatcaattcacaaagatcaagc-ttttttt |
34452096 |
T |
 |
Q |
223 |
nngcatcacaataacatcctttccttgtctcattttattttgtggatgaaatgaatctttaatccttttttcttcaataagcaatgaatctt |
314 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34452097 |
ttgcatcacaataacatcctttccttgtctcattttattttgtggatgaaatgaatctttaatccttttttcttcaataagcaatgaatctt |
34452188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3509 times since January 2019
Visitors: 4036