View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0628_low_27 (Length: 252)
Name: NF0628_low_27
Description: NF0628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0628_low_27 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 10 - 231
Target Start/End: Complemental strand, 44697699 - 44697478
Alignment:
| Q |
10 |
gcagagaccattgcaaaactatatgcatgcaaaatattttgattgcttaggtgtatataatctgagcacttttccttttttgtgaacatatgacacatga |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44697699 |
gcagagaccattgcaaaactatatgcatgcaaaatattttgattgcttaggtgtatacaatctgagcacttttccttttttgtgaacatatgacacatga |
44697600 |
T |
|
| Q |
110 |
aggaaattaaaaatgggaatgaccagatgacaactgcactccatcacnnnnnnnnttcgacacaatcttttgaaaataatcaaaatattgactccaacca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44697599 |
aggaaattaaaaatgggaatgaccagatgacaactgcactccatcacaaaaaaaattcgacacaatcttttgaaaataatcaaaatattgactccaacca |
44697500 |
T |
|
| Q |
210 |
accaatgcaggttgcaacttaa |
231 |
Q |
| |
|
|| |||||||||||| |||||| |
|
|
| T |
44697499 |
actaatgcaggttgcgacttaa |
44697478 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3307 times since January 2019
Visitors: 4031