View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0628_low_30 (Length: 213)

Name: NF0628_low_30
Description: NF0628
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0628_low_30
NF0628_low_30
[»] chr7 (23 HSPs)
chr7 (23-212)||(48161903-48162091)
chr7 (31-213)||(34389986-34390168)
chr7 (30-168)||(35745747-35745885)
chr7 (31-136)||(6584933-6585037)
chr7 (30-136)||(3867139-3867244)
chr7 (30-122)||(3419623-3419714)
chr7 (31-213)||(33435133-33435316)
chr7 (31-137)||(41089700-41089805)
chr7 (31-213)||(8745177-8745357)
chr7 (31-130)||(38306285-38306382)
chr7 (31-130)||(44353524-44353621)
chr7 (37-130)||(37795019-37795110)
chr7 (31-130)||(10244206-10244303)
chr7 (36-130)||(5860248-5860340)
chr7 (31-73)||(6716751-6716793)
chr7 (31-130)||(47325845-47325942)
chr7 (31-73)||(1320818-1320860)
chr7 (31-73)||(3478376-3478418)
chr7 (31-73)||(11379142-11379184)
chr7 (31-73)||(13311863-13311905)
chr7 (31-91)||(12480910-12480970)
chr7 (30-70)||(42533270-42533310)
chr7 (31-91)||(48058651-48058711)
[»] chr2 (21 HSPs)
chr2 (31-213)||(14405222-14405404)
chr2 (31-213)||(7874315-7874497)
chr2 (31-213)||(14106397-14106581)
chr2 (31-177)||(5254280-5254425)
chr2 (30-213)||(387196-387381)
chr2 (31-177)||(10173491-10173635)
chr2 (31-130)||(39338825-39338922)
chr2 (31-140)||(22885084-22885190)
chr2 (31-91)||(1269507-1269567)
chr2 (36-136)||(2062918-2063015)
chr2 (31-147)||(16960006-16960119)
chr2 (37-137)||(16952336-16952434)
chr2 (37-137)||(17023001-17023099)
chr2 (37-137)||(17060307-17060405)
chr2 (31-91)||(7695987-7696047)
chr2 (31-91)||(13337298-13337358)
chr2 (31-90)||(10524121-10524184)
chr2 (38-121)||(18681096-18681176)
chr2 (31-121)||(3745358-3745446)
chr2 (38-90)||(4471954-4472006)
chr2 (31-91)||(15126407-15126467)
[»] chr3 (19 HSPs)
chr3 (31-212)||(23328226-23328407)
chr3 (31-213)||(40023447-40023629)
chr3 (75-207)||(21342603-21342735)
chr3 (31-210)||(45398820-45398999)
chr3 (31-177)||(43012399-43012545)
chr3 (31-137)||(19176526-19176631)
chr3 (31-133)||(9584009-9584110)
chr3 (31-130)||(2392466-2392563)
chr3 (31-130)||(17550981-17551078)
chr3 (31-137)||(33143902-33144006)
chr3 (31-130)||(20611807-20611904)
chr3 (31-122)||(45163879-45163968)
chr3 (31-91)||(37123406-37123466)
chr3 (38-130)||(47235729-47235819)
chr3 (31-91)||(47945730-47945790)
chr3 (31-86)||(2394255-2394310)
chr3 (102-177)||(25647778-25647853)
chr3 (31-91)||(1652883-1652943)
chr3 (31-91)||(39021273-39021333)
[»] chr4 (19 HSPs)
chr4 (35-213)||(35341214-35341391)
chr4 (31-213)||(31050536-31050719)
chr4 (31-213)||(2825807-2825989)
chr4 (31-130)||(8255051-8255148)
chr4 (31-130)||(8268469-8268566)
chr4 (31-137)||(41117921-41118024)
chr4 (31-130)||(30964465-30964562)
chr4 (26-123)||(4305744-4305839)
chr4 (26-91)||(25753191-25753256)
chr4 (31-137)||(38637187-38637289)
chr4 (32-177)||(53823334-53823477)
chr4 (31-130)||(30167524-30167621)
chr4 (31-91)||(38929851-38929911)
chr4 (31-61)||(2792301-2792331)
chr4 (31-61)||(21387231-21387261)
chr4 (37-91)||(28966897-28966951)
chr4 (30-59)||(16833050-16833079)
chr4 (31-91)||(22811157-22811217)
chr4 (31-67)||(35800513-35800549)
[»] chr8 (18 HSPs)
chr8 (30-213)||(15821254-15821437)
chr8 (38-210)||(38577667-38577840)
chr8 (94-177)||(35816155-35816238)
chr8 (31-183)||(36630861-36631013)
chr8 (31-130)||(24995355-24995452)
chr8 (31-130)||(16457421-16457518)
chr8 (31-130)||(20138450-20138547)
chr8 (31-130)||(31207322-31207419)
chr8 (31-90)||(9519523-9519582)
chr8 (32-130)||(37986818-37986914)
chr8 (34-123)||(41893368-41893454)
chr8 (31-91)||(17656999-17657059)
chr8 (31-130)||(32066255-32066352)
chr8 (31-130)||(34388965-34389062)
chr8 (31-91)||(30236125-30236185)
chr8 (31-73)||(10248568-10248610)
chr8 (31-88)||(15906710-15906767)
chr8 (30-91)||(32945700-32945761)
[»] chr1 (15 HSPs)
chr1 (31-213)||(27031715-27031897)
chr1 (32-213)||(24658954-24659134)
chr1 (31-213)||(7857677-7857859)
chr1 (31-213)||(46814342-46814524)
chr1 (31-183)||(24684383-24684535)
chr1 (31-130)||(24449890-24449987)
chr1 (31-130)||(41920476-41920573)
chr1 (31-130)||(46692779-46692876)
chr1 (31-130)||(5389381-5389478)
chr1 (31-130)||(31585720-31585817)
chr1 (102-177)||(31290933-31291008)
chr1 (31-130)||(30685864-30685961)
chr1 (31-91)||(27102215-27102275)
chr1 (32-135)||(32864517-32864617)
chr1 (30-70)||(9313307-9313347)
[»] chr5 (13 HSPs)
chr5 (30-213)||(29087504-29087687)
chr5 (31-130)||(34378122-34378219)
chr5 (31-91)||(13954231-13954291)
chr5 (37-178)||(8297498-8297636)
chr5 (55-137)||(7162269-7162350)
chr5 (31-89)||(18593267-18593325)
chr5 (31-137)||(7195194-7195296)
chr5 (31-137)||(39184139-39184244)
chr5 (37-90)||(22675322-22675375)
chr5 (31-90)||(698385-698444)
chr5 (31-69)||(7392050-7392088)
chr5 (37-91)||(27713099-27713153)
chr5 (31-91)||(26045961-26046021)
[»] chr6 (4 HSPs)
chr6 (31-182)||(20701712-20701860)
chr6 (31-130)||(3117517-3117614)
chr6 (30-91)||(9224064-9224125)
chr6 (31-91)||(26216016-26216076)
[»] scaffold0200 (1 HSPs)
scaffold0200 (31-91)||(19407-19467)
[»] scaffold0119 (1 HSPs)
scaffold0119 (31-91)||(42135-42195)
[»] scaffold0050 (1 HSPs)
scaffold0050 (30-177)||(36730-36876)
[»] scaffold0068 (1 HSPs)
scaffold0068 (31-122)||(35740-35828)
[»] scaffold0343 (1 HSPs)
scaffold0343 (49-123)||(5747-5820)


Alignment Details
Target: chr7 (Bit Score: 146; Significance: 4e-77; HSPs: 23)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 23 - 212
Target Start/End: Complemental strand, 48162091 - 48161903
Alignment:
23 caaggggtgatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtc 122  Q
    ||||||||||||| ||||||||||||||||||| ||||| ||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||    
48162091 caaggggtgatcatttttgattcgagatcggaaatcagttctttggctcaaattgatttttggacttttgtttttgtgctcttttggtggatcagaggtc 48161992  T
123 gagaggttgtggaagttgcttgttcattaggttaggagcttttcgaatgtggctcgacttgtcgttgaagtctgggagttttattttgag 212  Q
    |||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |||||||||||| |||||||||| ||||    
48161991 gagaggttgtggaagttgcttgttcattgggtta-gagcttttcgaatgtggctcgacttggcgttgaagtctgagagttttattctgag 48161903  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 31 - 213
Target Start/End: Original strand, 34389986 - 34390168
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||  |||||||| || ||||||||||||||||| |||| ||||||||| |||||||| ||||||||||||||    
34389986 gatcacttttgattcgagatcgggagtcagctctttggcttaagttggtttttgggcttttatttt-gtgctctttcggtggatcggaggtcgagaggtt 34390084  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctcgactt-gtcgttgaagtctgggagttttattttgagg 213  Q
    ||||||| ||| |||||||| | ||||||||||||| |||||||||| |||| |  |||| |||||||||||||||||||||||    
34390085 gtggaagctgcatgttcattcgattaggagcttttcaaatgtggctcaacttgggtgttgtagtctgggagttttattttgagg 34390168  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 30 - 168
Target Start/End: Complemental strand, 35745885 - 35745747
Alignment:
30 tgatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggt 129  Q
    ||||||||||||||||||||||||||||||   ||||||||||| |||||||||||||||||||||||||||||||| |||||||  ||||| |||||||    
35745885 tgatcacttttgattcgagatcggaagtcatctctttggctcaagttggtttttgggcttttgtttttgtgctctttcggtggattggaggtggagaggt 35745786  T
130 tgtggaagttgcttgttcattaggttaggagcttttcga 168  Q
    |||||||| ||| |||||||| |||||||||||||||||    
35745785 tgtggaagctgcatgttcattcggttaggagcttttcga 35745747  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #4
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 31 - 136
Target Start/End: Original strand, 6584933 - 6585037
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||  |||||||| || |||||||||||||||||| ||||||||||||| |||||||| ||||| ||||||||    
6584933 gatcacttttgattcgagatcgggagtcagctctttggcttaagttggtttttgggcttttg-ttttgtgctctttcggtggatcggaggttgagaggtt 6585031  T
131 gtggaa 136  Q
    ||||||    
6585032 gtggaa 6585037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #5
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 30 - 136
Target Start/End: Original strand, 3867139 - 3867244
Alignment:
30 tgatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggt 129  Q
    |||||||||||||||||||| ||| ||||||| ||||| ||||| ||||||||||||||||||  |||||||||||  |||||||||||||||| |||||    
3867139 tgatcacttttgattcgagaccgggagtcagttctttgactcaagttggtttttgggcttttg-ctttgtgctcttgcggtggatcagaggtcgcgaggt 3867237  T
130 tgtggaa 136  Q
    | |||||    
3867238 tatggaa 3867244  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #6
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 30 - 122
Target Start/End: Complemental strand, 3419714 - 3419623
Alignment:
30 tgatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtc 122  Q
    |||||||||||||||||||||||| ||||||  ||||| ||||| ||||||||||||| ||||||| |||||||||| |||||||||||||||    
3419714 tgatcacttttgattcgagatcgggagtcagctctttgactcaagttggtttttgggc-tttgtttctgtgctctttcggtggatcagaggtc 3419623  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #7
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 31 - 213
Target Start/End: Original strand, 33435133 - 33435316
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| ||||| ||||| || |||| ||||| |||| ||||||||||||| |||||||| ||||||| ||||||    
33435133 gatcacttttgattcgagatcgggagtcagttctttgtctcaagttcgtttgtgggcatttg-ttttgtgctctttcggtggatcggaggtcgcgaggtt 33435231  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaa-tgtggctcgactt-gtcgttgaagtctgggagttttattttgagg 213  Q
    ||| ||| | | || || || ||| ||| ||| |||||| ||||||||  ||| || ||||| ||||| ||||||| ||||||||    
33435232 gtgaaagctacatgatccttcggtcaggtgctcttcgaattgtggctcagcttggttgttgaggtctgagagttttcttttgagg 33435316  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #8
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 31 - 137
Target Start/End: Complemental strand, 41089805 - 41089700
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||||||||||||||||||| || ||||||  ||||| ||||| |||||||||| ||||||| ||||||| ||||| |||||||| ||||||| ||||||    
41089805 gatcacttttgattcgagattgggagtcagctctttgactcaagttggtttttgagcttttg-ttttgtgatctttcggtggatcggaggtcgcgaggtt 41089707  T
131 gtggaag 137  Q
    |||||||    
41089706 gtggaag 41089700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #9
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 31 - 213
Target Start/End: Original strand, 8745177 - 8745357
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| | ||||| | |||| |||| || | ||||||||||||   | ||   ||||| |||||||| ||||||||||||||    
8745177 gatcacttttgattcgagatcgggattcagttcgttggatcaagtttggttttgggctttt---tatggtttctttcggtggatcggaggtcgagaggtt 8745273  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctc-gacttgtcgttgaagtctgggagttttattttgagg 213  Q
    ||||||| ||| || || ||  | ||||||||||||| ||||||||| |  |||  ||| ||| |||||||||| |||||||||    
8745274 gtggaagctgcatgatctttcagataggagcttttcggatgtggctcagctttggtgttcaagactgggagtttaattttgagg 8745357  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #10
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 130
Target Start/End: Original strand, 38306285 - 38306382
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||||||||||||||||||| || ||||||| ||||| ||||| ||||||||||||||||   | ||||||||||| | ||| || ||||||| ||||||    
38306285 gatcacttttgattcgagattgggagtcagttctttgactcaagttggtttttgggcttt--gtgttgtgctctttcgatggttcggaggtcgcgaggtt 38306382  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 44353621 - 44353524
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||||||||||||| |||||||| ||||||| ||||| || |  ||||||||||||||||   | ||||||||||| |||||||| ||||||| ||||||    
44353621 gatcacttttgatttgagatcgggagtcagttctttgacttatgttggtttttgggcttt--gtgttgtgctctttcggtggatcggaggtcgcgaggtt 44353524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #12
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 37 - 130
Target Start/End: Original strand, 37795019 - 37795110
Alignment:
37 ttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||| ||||||| |||||  |||| ||||||||||||||||   | ||||||||||| ||||| || ||||||| ||||||    
37795019 ttttgattcgagatcgggagtcagttctttgagtcaagttggtttttgggcttt--gtgttgtgctctttcggtggttcggaggtcgcgaggtt 37795110  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 130
Target Start/End: Original strand, 10244206 - 10244303
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| ||||| ||||| || |||||||| ||||   | |||||||||||  |||| || ||||||| ||||||    
10244206 gatcacttttgattcgagatcgggagtcagttctttgactcaagttagtttttggccttt--gtgttgtgctctttcagtggttcggaggtcgcgaggtt 10244303  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 36 - 130
Target Start/End: Complemental strand, 5860340 - 5860248
Alignment:
36 cttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||||||||||||||||| ||||| | ||||| | ||| ||||||||||||||||   | ||||||||||| ||||| || ||||||| ||||||    
5860340 cttttgattcgagatcgggagtcaattctttgacgcaagttggtttttgggcttt--gtgttgtgctctttcggtggttcggaggtcgcgaggtt 5860248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #15
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 31 - 73
Target Start/End: Complemental strand, 6716793 - 6716751
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaa 73  Q
    ||||||||||||||||||||||| ||||||| |||||||||||    
6716793 gatcacttttgattcgagatcgggagtcagttctttggctcaa 6716751  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 47325942 - 47325845
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||| ||||||||| |||||||| ||||||  ||||| ||||| ||||||||||||||||   |  |||||||||| | |||||| ||||||| ||||||    
47325942 gatcgcttttgatttgagatcgggagtcagctctttgactcaagttggtttttgggcttt--gtgctgtgctctttcgatggatcggaggtcgcgaggtt 47325845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 73
Target Start/End: Original strand, 1320818 - 1320860
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaa 73  Q
    ||||||||||||||| | ||||||||||||| |||||||||||    
1320818 gatcacttttgattcaaaatcggaagtcagttctttggctcaa 1320860  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #18
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 73
Target Start/End: Original strand, 3478376 - 3478418
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaa 73  Q
    ||||||||||||||||||||||| ||| ||| |||||||||||    
3478376 gatcacttttgattcgagatcgggagttagttctttggctcaa 3478418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #19
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 73
Target Start/End: Complemental strand, 11379184 - 11379142
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaa 73  Q
    |||| |||||||||||||||||| |||||||||||||| ||||    
11379184 gatcgcttttgattcgagatcgggagtcagtactttggttcaa 11379142  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #20
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 73
Target Start/End: Original strand, 13311863 - 13311905
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaa 73  Q
    ||||||||||||||||||||||| ||||||| |||||| ||||    
13311863 gatcacttttgattcgagatcgggagtcagttctttggttcaa 13311905  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 12480910 - 12480970
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    |||| |||||||||||||||||| ||||||| |||||| |||| || | |||| |||||||    
12480910 gatcgcttttgattcgagatcgggagtcagttctttggttcaagtttggtttttggctttt 12480970  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #22
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 42533310 - 42533270
Alignment:
30 tgatcacttttgattcgagatcggaagtcagtactttggct 70  Q
    |||||||||||||||||||||||| ||||| | ||||||||    
42533310 tgatcacttttgattcgagatcgggagtcaatcctttggct 42533270  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #23
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 91
Target Start/End: Complemental strand, 48058711 - 48058651
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    |||| ||||||||| ||||||||||||||||  |||||||||| || | |||||| |||||    
48058711 gatcgcttttgatttgagatcggaagtcagttttttggctcaagtttggttttggcctttt 48058651  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 104; Significance: 5e-52; HSPs: 21)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 31 - 213
Target Start/End: Original strand, 14405222 - 14405404
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||  ||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||| |||||| ||||    
14405222 gatcacttttgattcgagatcgggagtcagctctttggctcaagttggtttttgggcttttg-ttttgtgctctttcggtggatcagaagtcgagtggtt 14405320  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctcgactt-gtcgttgaagtctgggagttttattttgagg 213  Q
    ||||||  |||  ||||||| |||||||||||| ||| |||||||||||||| |  ||||||||||||||||||||||||||||    
14405321 gtggaaactgcacgttcatttggttaggagcttgtcgcatgtggctcgacttgggtgttgaagtctgggagttttattttgagg 14405404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 31 - 213
Target Start/End: Original strand, 7874315 - 7874497
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||  ||||| ||||| |||||||||||||||||||||| |||||| || |||||||| ||||||||||||||    
7874315 gatcacttttgattcgagatcgggagtcagctctttgactcaagttggtttttgggcttttgtttt-gtgctcattcggtggatcggaggtcgagaggtt 7874413  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctcgactt-gtcgttgaagtctgggagttttattttgagg 213  Q
    ||||||  | |||||||||| ||||||||||||||||||||||||||  ||| |  |||||||||| |||||||||||||||||    
7874414 gtggaaactacttgttcatttggttaggagcttttcgaatgtggctcagcttgggtgttgaagtcttggagttttattttgagg 7874497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 31 - 213
Target Start/End: Complemental strand, 14106581 - 14106397
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctca-aattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggt 129  Q
    ||||||||||||||| ||||||| ||||||  |||| | |||   |||||||||||| ||||||||||||||||||| ||||||||||||||||||||||    
14106581 gatcacttttgattcaagatcgggagtcagctctttagatcagttttggtttttgggtttttgtttttgtgctctttcggtggatcagaggtcgagaggt 14106482  T
130 tgtggaagttgcttgttcattaggttaggagcttttcgaatgtggctcgactt-gtcgttgaagtctgggagttttattttgagg 213  Q
    |||||||||||  || ||||| ||||| ||||||| ||||||||||||  ||| |  ||||||||||| ||||||||||||||||    
14106481 tgtggaagttgtatgatcattcggttaagagctttacgaatgtggctcagcttgggtgttgaagtctgagagttttattttgagg 14106397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 31 - 177
Target Start/End: Original strand, 5254280 - 5254425
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||||||||| ||| |||||||| |||| |  |||||| |||| |||||||| ||||||||||||| ||||| ||| |||||||| ||||||||||||||    
5254280 gatcacttttaatttgagatcgggagtctgctctttggttcaagttggttttcgggcttttgtttt-gtgctttttcggtggatcggaggtcgagaggtt 5254378  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctc 177  Q
    ||||||| ||| |||||||| |||| |||||||||||||||||||||    
5254379 gtggaagctgcatgttcattcggtttggagcttttcgaatgtggctc 5254425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 30 - 213
Target Start/End: Original strand, 387196 - 387381
Alignment:
30 tgatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggt 129  Q
    ||||||||||||||| |||||||| ||||| | ||||| ||||| |||||||||| |||||||||||||||||||||||||||||| ||||||  |||||    
387196 tgatcacttttgatttgagatcgggagtcaattctttgactcaagttggtttttgagcttttgtttttgtgctcttttggtggatcggaggtcacgaggt 387295  T
130 tgtggaagttgcttgttcattaggttaggagcttttcga-atgtggctcgactt-gtcgttgaagtctgggagttttattttgagg 213  Q
    | |||||| ||| ||||||||  || ||| ||| ||||| | |||||||  ||| |  ||||  ||||||||||||||||||||||    
387296 tttggaagctgcatgttcattcagtcaggtgctcttcgataggtggctcagcttgggtgttggggtctgggagttttattttgagg 387381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 31 - 177
Target Start/End: Complemental strand, 10173635 - 10173491
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||||||| |||  |||||||||| || | |||||||||||||  || ||| ||||| |||| ||| |||||||||||||     
10173635 gatcacttttgattcgagatcggaagtaagttatttggctcaagtttggttttgggcttttg--ttggtgttctttcggtgaatcggaggtcgagaggtg 10173538  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctc 177  Q
    ||||||||||  || || || |  || |||||||||| |||||||||    
10173537 gtggaagttgaatgatcttttgaatatgagcttttcggatgtggctc 10173491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 39338922 - 39338825
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||| |||||||||||||||||| ||||||| ||||| ||||| ||||||||||||||||   | ||||||||||| |||||||| ||||||| ||||||    
39338922 gatcgcttttgattcgagatcgggagtcagttctttgactcaagttggtttttgggcttt--gtgttgtgctctttcggtggatcggaggtcgcgaggtt 39338825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #8
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 31 - 140
Target Start/End: Complemental strand, 22885190 - 22885084
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| |||||| |||| || | |||||||   ||||||| ||| ||||| |||||| ||||||| |||||||     
22885190 gatcacttttgattcgagatcgggagtcagttctttggttcaagtttggttttggg---ttgttttggtgttctttcggtggaccagaggttgagaggtg 22885094  T
131 gtggaagttg 140  Q
    ||||||||||    
22885093 gtggaagttg 22885084  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #9
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 1269507 - 1269567
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||||||||||||||||||||||||||||| ||||||||||| || | ||||||| ||||    
1269507 gatcacttttgattcgagatcggaagtcagttctttggctcaagtttggttttgggatttt 1269567  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #10
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 36 - 136
Target Start/End: Original strand, 2062918 - 2063015
Alignment:
36 cttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggttgtgga 135  Q
    |||||||||||||||||| ||||||  ||||||||||| || | ||||||||||   |||| ||| ||||| |||| | ||||||| | |||||||||||    
2062918 cttttgattcgagatcgggagtcagctctttggctcaagtttggttttgggctt---ttttggtgttctttcggtgtaccagaggttgtgaggttgtgga 2063014  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #11
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 31 - 147
Target Start/End: Original strand, 16960006 - 16960119
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||| |||||||||||||||||  ||||||| ||||||||||| || | ||||||||||    ||| ||| ||||| |||||| ||||||| | ||| |     
16960006 gatcgcttttgattcgagatcgagagtcagttctttggctcaagtttggttttgggctt---atttggtgttctttcggtggaccagaggttgtgagctg 16960102  T
131 gtggaagttgcttgttc 147  Q
    |||||||||| ||||||    
16960103 gtggaagttgattgttc 16960119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #12
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 37 - 137
Target Start/End: Complemental strand, 16952434 - 16952336
Alignment:
37 ttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggttgtggaa 136  Q
    ||||||||||||||||| || |||| ||||||||||| || | |||||| | ||  |||| ||| ||||| |||||||| ||||| ||||||| ||||||    
16952434 ttttgattcgagatcgggagccagttctttggctcaagtttggttttggacatt--ttttggtgttctttcggtggatcggaggttgagaggtggtggaa 16952337  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #13
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 37 - 137
Target Start/End: Complemental strand, 17023099 - 17023001
Alignment:
37 ttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggttgtggaa 136  Q
    ||||||||||||||||| || |||| ||||||||||| || | |||||| | ||  |||| ||| ||||| |||||||| ||||| ||||||| ||||||    
17023099 ttttgattcgagatcgggagccagttctttggctcaagtttggttttggacatt--ttttggtgttctttcggtggatcggaggttgagaggtggtggaa 17023002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 37 - 137
Target Start/End: Complemental strand, 17060405 - 17060307
Alignment:
37 ttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggttgtggaa 136  Q
    ||||||||||||||||| || |||| ||||||||||| || | |||||| | ||  |||| ||| ||||| |||||||| ||||| ||||||| ||||||    
17060405 ttttgattcgagatcgggagccagttctttggctcaagtttggttttggacatt--ttttggtgttctttcggtggatcggaggttgagaggtggtggaa 17060308  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 7695987 - 7696047
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||||||||||||||| | ||| ||||||| ||||||||||| || | ||||||||||||    
7695987 gatcacttttgattcgataccgggagtcagttctttggctcaagttaggttttgggctttt 7696047  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #16
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 13337298 - 13337358
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||||||||||||||| ||||||||||||| ||||| ||||| || | |||||| |||||    
13337298 gatcacttttgattcgaaatcggaagtcagttctttgactcaagttaggttttggactttt 13337358  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #17
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 90
Target Start/End: Original strand, 10524121 - 10524184
Alignment:
31 gatcacttttgattcgagatcggaagtcagta----ctttggctcaaattggtttttgggcttt 90  Q
    ||||||||||||||||||||||| ||||| ||    ||||| ||||| ||||||||||||||||    
10524121 gatcacttttgattcgagatcgggagtcaatatattctttgactcaagttggtttttgggcttt 10524184  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 38 - 121
Target Start/End: Original strand, 18681096 - 18681176
Alignment:
38 tttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggt 121  Q
    |||||||||||||||| ||||||| || ||| |||| || | |||||||||||||   | ||| || |||||||||||||||||    
18681096 tttgattcgagatcgggagtcagttctctggttcaagtttggttttgggcttttg---tggtgttcctttggtggatcagaggt 18681176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 121
Target Start/End: Original strand, 3745358 - 3745446
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaa-attggtttttgggcttttgtttttgtgctcttttggtggatcagaggt 121  Q
    |||| ||||| |||||||||||||||||||| |||||| | ||  || |||||||||||||| || ||||  ||||| ||||||||||||||    
3745358 gatcgcttttaattcgagatcggaagtcagttctttggtttaagttttgtttttgggctttt-ttgttgt--tctttcggtggatcagaggt 3745446  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #20
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 38 - 90
Target Start/End: Original strand, 4471954 - 4472006
Alignment:
38 tttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttt 90  Q
    |||||||||||||||| ||||||| |||||  |||| || |||||||||||||    
4471954 tttgattcgagatcgggagtcagttctttgattcaagtttgtttttgggcttt 4472006  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #21
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 91
Target Start/End: Complemental strand, 15126467 - 15126407
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||| ||||||||||||||||| |||| || ||||||||||  || | ||||||||||||    
15126467 gatcatttttgattcgagatcgggagtcggttctttggctcatgtttggttttgggctttt 15126407  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 103; Significance: 2e-51; HSPs: 19)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 31 - 212
Target Start/End: Complemental strand, 23328407 - 23328226
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||| ||   |||||||||| |||||||||| ||||||||||| ||||||||| |||||||| ||||||||||||||    
23328407 gatcacttttgattcgagatcgggagttagctttttggctcaagttggtttttgagcttttgtttt-gtgctctttcggtggatcggaggtcgagaggtt 23328309  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctcgactt-gtcgttgaagtctgggagttttattttgag 212  Q
    ||||||| | |||||||||| ||||||||||||||||||||||||||  ||| |  |||||||||||||||||||||||||||    
23328308 gtggaagctccttgttcattcggttaggagcttttcgaatgtggctcagcttgggtgttgaagtctgggagttttattttgag 23328226  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 31 - 213
Target Start/End: Complemental strand, 40023629 - 40023447
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||  | |||||||| || |||||||||||||||||||||| ||||||||| ||||||||||||| || ||||||    
40023629 gatcacttttgattcgagatcgggagtcgattctttggcttaagttggtttttgggcttttgtttt-gtgctctttcggtggatcagaggacgggaggtt 40023531  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctcgact-tgtcgttgaagtctgggagttttattttgagg 213  Q
    ||||||| ||| |||||||| ||||||||||||||||||||||||||  ||  |  |||| |||||||||||||||||||||||    
40023530 gtggaagctgcatgttcattcggttaggagcttttcgaatgtggctcagctagggtgttgtagtctgggagttttattttgagg 40023447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 82; E-Value: 7e-39
Query Start/End: Original strand, 75 - 207
Target Start/End: Original strand, 21342603 - 21342735
Alignment:
75 ttggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggttgtggaagttgcttgttcattaggttaggagcttttcgaatgtgg 174  Q
    ||||||||| |||||||||||| ||||||||| | |||||||||||||||||||||||||||| |||||||||||| |||||| ||||||||||||||||    
21342603 ttggtttttaggcttttgtttt-gtgctctttcgatggatcagaggtcgagaggttgtggaagctgcttgttcattcggttagaagcttttcgaatgtgg 21342701  T
175 ctcgactt-gtcgttgaagtctgggagttttatt 207  Q
    |||||||| |  ||||||||||| ||||||||||    
21342702 ctcgacttgggtgttgaagtctgagagttttatt 21342735  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 31 - 210
Target Start/End: Original strand, 45398820 - 45398999
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||  ||||||  |||||  | || ||||||||||||||||||||||  |||||||| | |||||| ||||||||||||||    
45398820 gatcacttttgattcgagatcgagagtcagctctttgatttaagttggtttttgggcttttgtttta-tgctctttcgatggatcggaggtcgagaggtt 45398918  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctcgactt-gtcgttgaagtctgggagttttattttg 210  Q
    ||||||| ||| |||||||| ||||| |||||||||||||||||| | |||| |  |||||||| |||||||| |||||||    
45398919 gtggaagctgcatgttcattcggttatgagcttttcgaatgtggcgcaacttaggtgttgaagtttgggagttctattttg 45398999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 31 - 177
Target Start/End: Original strand, 43012399 - 43012545
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| ||||| ||||| |||||||||| ||||||| ||||||||||||| |||| ||||||||||| ||||||    
43012399 gatcacttttgattcgagatcgggagtcagttctttgactcaagttggtttttgagcttttg-ttttgtgctctttcggtgaatcagaggtcgcgaggtt 43012497  T
131 gtggaagttgcttgttcattaggttaggagcttttcg-aatgtggctc 177  Q
    ||||||||||| || || || ||| ||| ||| |||| ||||||||||    
43012498 gtggaagttgcatgatcgttcggtcaggtgctcttcgaaatgtggctc 43012545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 31 - 137
Target Start/End: Original strand, 19176526 - 19176631
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| ||||| ||||| ||||||||||||||||||  ||||||||||||||||||||| |||||||  |||||    
19176526 gatcacttttgattcgagatcgggagtcagttctttgactcaagttggtttttgggcttttg-atttgtgctcttttggtggatcggaggtcgcaaggtt 19176624  T
131 gtggaag 137  Q
    |||||||    
19176625 gtggaag 19176631  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 31 - 133
Target Start/End: Complemental strand, 9584110 - 9584009
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| ||||| |||||  ||||||||||||||||| ||||||| ||||| |||||||| ||||| | ||||||    
9584110 gatcacttttgattcgagatcgggagtcagttctttgtctcaagatggtttttgggcttttg-ttttgtgatctttcggtggatcggaggttgcgaggtt 9584012  T
131 gtg 133  Q
    |||    
9584011 gtg 9584009  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #8
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 2392563 - 2392466
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||||||||||||||||||| |||||||||| ||||| || || ||||||||||||||||   | ||||||||||| |||||||| ||||||| ||||||    
2392563 gatcacttttgattcgagattggaagtcagttctttgtcttaagttggtttttgggcttt--gtgttgtgctctttcggtggatcggaggtcgcgaggtt 2392466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 31 - 130
Target Start/End: Original strand, 17550981 - 17551078
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| ||||| ||||| ||||||||||||||||   | ||||||||||| | || ||| ||||||| ||||||    
17550981 gatcacttttgattcgagatcgggagtcagttctttgactcaagttggtttttgggcttt--gtgttgtgctctttcgatgcatcggaggtcgcgaggtt 17551078  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #10
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 31 - 137
Target Start/End: Complemental strand, 33144006 - 33143902
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaa-attggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggt 129  Q
    ||||||||||||||||||||||| ||||||| |||||| |||| ||| ||||||||||||   ||| ||   ||||| |||||||||||||||| |||||    
33144006 gatcacttttgattcgagatcgggagtcagttctttggatcaagattagtttttgggctt---tttatggtttctttcggtggatcagaggtcgcgaggt 33143910  T
130 tgtggaag 137  Q
     |||||||    
33143909 ggtggaag 33143902  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #11
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 130
Target Start/End: Original strand, 20611807 - 20611904
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||| ||||||||||||||||| ||||||| ||||| || || ||||||||||||||||     ||||||||||| |||||||| ||||||| ||||||    
20611807 gatcatttttgattcgagatcgggagtcagttctttgacttaagttggtttttgggcttt--gcgttgtgctctttcggtggatcggaggtcgcgaggtt 20611904  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 122
Target Start/End: Original strand, 45163879 - 45163968
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtc 122  Q
    ||||||||||||||||||||| |||||||||  |||| || || ||||||||||||||||   | ||||||||||| |||||||| ||||||    
45163879 gatcacttttgattcgagatcagaagtcagttttttgtcttaagttggtttttgggcttt--gtgttgtgctctttcggtggatcggaggtc 45163968  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 37123406 - 37123466
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    |||||||||||||||||||| || ||||||| |||||| ||||||| | ||||||||||||    
37123406 gatcacttttgattcgagattgggagtcagttctttggatcaaatttggttttgggctttt 37123466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #14
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 38 - 130
Target Start/End: Original strand, 47235729 - 47235819
Alignment:
38 tttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||||||||||||||  |||| || ||||| || || ||||||||||||| ||||| ||| |||||||| |||||||||||||||| ||||||    
47235729 tttgattcgagatcgagagtcggttctttgacttaagttggtttttgggc-tttgtgttt-tgctctttcggtggatcagaggtcgcgaggtt 47235819  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #15
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 47945730 - 47945790
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||||||||||||||||||||| |||||||  |||||||||| || | ||||||||||||    
47945730 gatcacttttgattcgagatcgggagtcagttatttggctcaagtttgattttgggctttt 47945790  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #16
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 31 - 86
Target Start/End: Complemental strand, 2394310 - 2394255
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttggg 86  Q
    |||||||||||||||||||| |||||||||| ||||| || || ||||||||||||    
2394310 gatcacttttgattcgagattggaagtcagttctttgtcttaagttggtttttggg 2394255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 102 - 177
Target Start/End: Original strand, 25647778 - 25647853
Alignment:
102 tcttttggtggatcagaggtcgagaggttgtggaagttgcttgttcattaggttaggagcttttcgaatgtggctc 177  Q
    |||||||||||||| ||||||||||||| ||| ||||||  || || || ||||| |||||||||| | |||||||    
25647778 tcttttggtggatcggaggtcgagaggtggtgaaagttgaatgatctttcggttatgagcttttcggacgtggctc 25647853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 91
Target Start/End: Complemental strand, 1652943 - 1652883
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||||||||||||||||||| | ||| ||| |||||| |||| || | ||||||||||||    
1652943 gatcacttttgattcgagatcaggagttagttctttggttcaagtttggttttgggctttt 1652883  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 91
Target Start/End: Complemental strand, 39021333 - 39021273
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    |||||||||||||||||| |||| ||||||| |||||| |||| |  | ||||||||||||    
39021333 gatcacttttgattcgaggtcgggagtcagttctttggatcaagtctggttttgggctttt 39021273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 95; Significance: 1e-46; HSPs: 19)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 35 - 213
Target Start/End: Complemental strand, 35341391 - 35341214
Alignment:
35 acttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggttgtgg 134  Q
    ||||||||| ||||||||||||||||  ||||||||||| ||||||||||| |||||||||| ||||||||| |||||||| ||| ||||||||||||||    
35341391 acttttgatccgagatcggaagtcagctctttggctcaagttggtttttggccttttgtttt-gtgctctttcggtggatcggagttcgagaggttgtgg 35341293  T
135 aagttgcttgttcattaggttaggagcttttcgaatgtggctcgacttgtcgttgaagtctgggagttttattttgagg 213  Q
    ||| ||| ||||||||  |||| ||||||||||||||||||||   |||  |||||||| |||||||||||||||||||    
35341292 aagctgcatgttcattcagttatgagcttttcgaatgtggctcagtttggtgttgaagtttgggagttttattttgagg 35341214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 31 - 213
Target Start/End: Complemental strand, 31050719 - 31050536
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||||||| ||  |||||| |  | ||||||||||||||||||||||||||||||||  ||||||| ||||||||||||||    
31050719 gatcacttttgattcgagatcggaagttaggtctttggtttgagttggtttttgggcttttgtttttgtgctctttcagtggatcggaggtcgagaggtt 31050620  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctcgactt-gtcgttgaagtctgggagttttattttgagg 213  Q
    ||||||| ||| |||||||| ||||||||||||||||| |||||||   ||| |  ||||||||||||  ||||||||||||||    
31050619 gtggaagctgcatgttcattcggttaggagcttttcgattgtggctaagcttgggtgttgaagtctggctgttttattttgagg 31050536  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 31 - 213
Target Start/End: Original strand, 2825807 - 2825989
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||| ||||||||||||||||| | |||   |||||||||||  |||||||||||||||| |||| || |||||| |||||||| |||||| |||||||    
2825807 gatcatttttgattcgagatcgggaatcacctctttggctcaatgtggtttttgggcttttatttt-gtactctttcggtggatcggaggtctagaggtt 2825905  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctc-gacttgtcgttgaagtctgggagttttattttgagg 213  Q
    ||||||| ||| |||||||| |||||||||||||||||| |||| || |  | |  |||||||| |||||||||||||||||||    
2825906 gtggaagctgcatgttcattcggttaggagcttttcgaaggtggttcagtttgggtgttgaagtttgggagttttattttgagg 2825989  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 31 - 130
Target Start/End: Original strand, 8255051 - 8255148
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||| ||||||| ||||||||| ||||| ||||| ||||||||||||||||   ||||||||||||| |||||||| ||||||| ||||||    
8255051 gatcacttttgatccgagatcagaagtcagttctttgactcaagttggtttttgggcttt--gttttgtgctctttcggtggatcggaggtcgcgaggtt 8255148  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 31 - 130
Target Start/End: Original strand, 8268469 - 8268566
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||| ||||||| ||||||||| ||||| ||||| ||||||||||||||||   ||||||||||||| |||||||| ||||||| ||||||    
8268469 gatcacttttgatccgagatcagaagtcagttctttgactcaagttggtttttgggcttt--gttttgtgctctttcggtggatcggaggtcgcgaggtt 8268566  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 31 - 137
Target Start/End: Complemental strand, 41118024 - 41117921
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||||||| ||| |||||||||||||| | ||||||||||   ||| ||   ||||| | ||||||||||||||||||||     
41118024 gatcacttttgattcgagatcggaagtaagttctttggctcaaattaggttttgggctt---tttatggtttctttcgatggatcagaggtcgagaggtg 41117928  T
131 gtggaag 137  Q
    |||||||    
41117927 gtggaag 41117921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 31 - 130
Target Start/End: Original strand, 30964465 - 30964562
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||||||||||||||| |||||| |||| || ||||| ||||| |||||||||||| ||||| | ||||||||||||||||| || ||||||| ||||||    
30964465 gatcacttttgattcgtgatcgggagtccgttctttgactcaagttggtttttggg-ttttg-tgttgtgctcttttggtggttcggaggtcgcgaggtt 30964562  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 26 - 123
Target Start/End: Original strand, 4305744 - 4305839
Alignment:
26 ggggtgatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcg 123  Q
    |||| ||||||||||||||||||||||| ||| ||| ||||| ||||| ||||||||| ||||||   | |||||||||||||||||  |||||||||    
4305744 ggggcgatcacttttgattcgagatcgggagttagttctttgtctcaagttggtttttaggcttt--gtgttgtgctcttttggtggtccagaggtcg 4305839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 42; E-Value: 0.000000000000005
Query Start/End: Original strand, 26 - 91
Target Start/End: Original strand, 25753191 - 25753256
Alignment:
26 ggggtgatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    |||| ||||||||||||||||||||||| ||||||| ||||||||||| || | ||||||||||||    
25753191 ggggcgatcacttttgattcgagatcgggagtcagttctttggctcaagtttgattttgggctttt 25753256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 137
Target Start/End: Complemental strand, 38637289 - 38637187
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||| | |||||||| || | || ||||||||||   ||| ||   |||||||||||||| |||||||||||||     
38637289 gatcacttttgattcgagatcgggagtcaattctttggcttaagtagg-ttttgggctt---tttatggtttcttttggtggatcggaggtcgagaggtg 38637194  T
131 gtggaag 137  Q
    |||||||    
38637193 gtggaag 38637187  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 177
Target Start/End: Complemental strand, 53823477 - 53823334
Alignment:
32 atcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggttg 131  Q
    |||||||||||||||||||||| ||||||| ||||||||||| || | |||||||   || ||| ||   ||||| ||| ||||  |||||||||||| |    
53823477 atcacttttgattcgagatcgggagtcagttctttggctcaagtttggttttggg---ttttttatggtttctttcggttgatcgaaggtcgagaggtgg 53823381  T
132 tggaagttgcttgttc-attaggttaggagcttttcgaatgtggctc 177  Q
    ||||||||| ||| ||  || || ||||||||||| | |||||||||    
53823380 tggaagttgattgatctttttggataggagcttttaggatgtggctc 53823334  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 30167621 - 30167524
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| |||| || ||||| ||||| ||| |||||||| |||   | ||||||||||| |||||  | ||||||| ||||||    
30167621 gatcacttttgattcgagatcgggagtcggttctttgactcaagttgatttttggggttt--gtgttgtgctctttcggtggtccggaggtcgcgaggtt 30167524  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #13
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 38929851 - 38929911
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    |||||||||||||||||||||   ||||||| ||||||||||| || | ||||||||||||    
38929851 gatcacttttgattcgagatcaagagtcagttctttggctcaagtttgattttgggctttt 38929911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #14
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 61
Target Start/End: Complemental strand, 2792331 - 2792301
Alignment:
31 gatcacttttgattcgagatcggaagtcagt 61  Q
    |||||||||||||||||||||||||||||||    
2792331 gatcacttttgattcgagatcggaagtcagt 2792301  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #15
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 61
Target Start/End: Complemental strand, 21387261 - 21387231
Alignment:
31 gatcacttttgattcgagatcggaagtcagt 61  Q
    |||||||||||||||||||||||||||||||    
21387261 gatcacttttgattcgagatcggaagtcagt 21387231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 91
Target Start/End: Original strand, 28966897 - 28966951
Alignment:
37 ttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    |||||||||||||| || ||||||| ||||||||||| || | ||||||||||||    
28966897 ttttgattcgagattgggagtcagttctttggctcaagtttggttttgggctttt 28966951  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 30 - 59
Target Start/End: Complemental strand, 16833079 - 16833050
Alignment:
30 tgatcacttttgattcgagatcggaagtca 59  Q
    ||||||||||||||||||||||||||||||    
16833079 tgatcacttttgattcgagatcggaagtca 16833050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #18
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 91
Target Start/End: Complemental strand, 22811217 - 22811157
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||| |||| |||||||||||| ||||||| ||||||||||| || | |||| |||||||    
22811217 gatcattttttattcgagatcgggagtcagttctttggctcaagtttggttttaggctttt 22811157  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #19
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 67
Target Start/End: Original strand, 35800513 - 35800549
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttg 67  Q
    |||| |||||||||||||||||||||||||| |||||    
35800513 gatcgcttttgattcgagatcggaagtcagttctttg 35800549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 93; Significance: 2e-45; HSPs: 18)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 30 - 213
Target Start/End: Complemental strand, 15821437 - 15821254
Alignment:
30 tgatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggt 129  Q
    |||||||||||||||||||||||| ||||||  ||||| || |  |||||||||||||||||| |||||||||||||  |||||||||||||||||||||    
15821437 tgatcacttttgattcgagatcgggagtcagctctttgacttatgttggtttttgggcttttg-ttttgtgctctttcagtggatcagaggtcgagaggt 15821339  T
130 tgtggaagttgcttgttcattaggttaggagcttttcgaatgtggctcgact-tgtcgttgaagtctgggagttttattttgagg 213  Q
    |||||||    |||||||||| ||||||||||||||||||||||||||  ||  |  ||||||||||||||||||||||||||||    
15821338 tgtggaaacaacttgttcatttggttaggagcttttcgaatgtggctcagctcggatgttgaagtctgggagttttattttgagg 15821254  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 79; E-Value: 4e-37
Query Start/End: Original strand, 38 - 210
Target Start/End: Complemental strand, 38577840 - 38577667
Alignment:
38 tttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggttgtggaag 137  Q
    |||||||||||||||| ||| ||| |||||| | || ||||||||||| |||||||||| ||||||||| |||||||||||||||||||| |||||||||    
38577840 tttgattcgagatcgggagttagttctttggtttaagttggtttttggacttttgtttt-gtgctctttcggtggatcagaggtcgagagtttgtggaag 38577742  T
138 ttgcttgttcattaggttaggagcttttcgaatgtggctcgactt-gtcgttgaagtct-gggagttttattttg 210  Q
     ||| |||||||| |||| |||||||||||||| |||| | |||| |  |||||||||| |||||||||||||||    
38577741 ctgcatgttcattcggtttggagcttttcgaatatggcgcaacttgggtgttgaagtctggggagttttattttg 38577667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 94 - 177
Target Start/End: Complemental strand, 35816238 - 35816155
Alignment:
94 ttttgtgctcttttggtggatcagaggtcgagaggttgtggaagttgcttgttcattaggttaggagcttttcgaatgtggctc 177  Q
    |||||||||||||||||||||| ||||| ||||| ||||||||| ||| |||||||| ||||| ||| ||||||||||||||||    
35816238 ttttgtgctcttttggtggatcggaggttgagagattgtggaagctgcatgttcattcggttaagagtttttcgaatgtggctc 35816155  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 31 - 183
Target Start/End: Original strand, 36630861 - 36631013
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||||||||| ||||||||||||  |||||| ||||| ||| | || ||||||||||||||| ||||||||||||| | |||||| ||||||| ||||||    
36630861 gatcacttttaattcgagatcgggtgtcagttctttgactctagtttgtttttgggcttttg-ttttgtgctctttcgatggatcggaggtcgcgaggtt 36630959  T
131 gtggaagttgcttgttcattaggttaggagcttttcg-aatgtggctcgacttg 183  Q
    |||| || ||| || || || ||| ||| ||| |||| |||||||||| |||||    
36630960 gtgggagctgcatgatccttcggtcaggtgctcttcgaaatgtggctcaacttg 36631013  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 24995452 - 24995355
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| ||||| ||||| ||||||||||||||||   | |||||||||||  |||| |||||||||| ||||||    
24995452 gatcacttttgattcgagatcgggagtcagttctttgactcaagttggtttttgggcttt--gtgttgtgctctttcagtgggtcagaggtcgcgaggtt 24995355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 16457518 - 16457421
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| ||||| ||||| ||||||||| ||||||   | ||||||||||| ||||| || || |||| ||||||    
16457518 gatcacttttgattcgagatcgggagtcagttctttgactcaagttggtttttaggcttt--gtgttgtgctctttcggtggttcggatgtcgtgaggtt 16457421  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 130
Target Start/End: Original strand, 20138450 - 20138547
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||||||||||||| |||||||| ||||||| ||||| || |  ||||||||||||||||   | ||||||||||| |||||||| ||||||| ||||||    
20138450 gatcacttttgatttgagatcgggagtcagttctttgacttatgttggtttttgggcttt--gtgttgtgctctttcggtggatcggaggtcgcgaggtt 20138547  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 31207419 - 31207322
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| ||||| ||||| |||| ||||||| |||   | ||||||| ||| |||||||| ||||||| ||||||    
31207419 gatcacttttgattcgagatcgggagtcagttctttgactcaagttggattttgggattt--gtgttgtgctttttcggtggatcggaggtcgcgaggtt 31207322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 31 - 90
Target Start/End: Original strand, 9519523 - 9519582
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttt 90  Q
    ||||| ||||||||||||||||| ||||||| ||||| ||||| ||||||||||||||||    
9519523 gatcagttttgattcgagatcgggagtcagttctttgactcaagttggtttttgggcttt 9519582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 32 - 130
Target Start/End: Complemental strand, 37986914 - 37986818
Alignment:
32 atcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||| ||||||||||||||||| ||||||| ||||| ||||| |||||||||| |||||   | ||||||||||| ||||| || ||||||| ||||||    
37986914 atcatttttgattcgagatcgggagtcagttctttgactcaagttggtttttgtgcttt--gtgttgtgctctttcggtggttcggaggtcgcgaggtt 37986818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 34 - 123
Target Start/End: Complemental strand, 41893454 - 41893368
Alignment:
34 cacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcg 123  Q
    |||||||||||||||||||| ||||||| ||||| ||||| || |||||||||||||   | ||||||||||||||||| | ||||||||    
41893454 cacttttgattcgagatcgggagtcagttctttgtctcaagtt-gtttttgggcttt--gtgttgtgctcttttggtggttaagaggtcg 41893368  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 91
Target Start/End: Complemental strand, 17657059 - 17656999
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||||||||||||||||||||| ||||||| ||||||||||| || | |||||| |||||    
17657059 gatcacttttgattcgagatcgggagtcagttctttggctcaagtttggttttggactttt 17656999  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 32066352 - 32066255
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||| ||||| ||||||  ||||| ||| | ||||||||||||||||   | ||||||||||| ||||| |||||||| | ||||||    
32066352 gatcacttttgattcgaaatcgggagtcagctctttgactccagttggtttttgggcttt--gtgttgtgctctttcggtggttcagaggttgcgaggtt 32066255  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 34389062 - 34388965
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||||||||||||||||||||   ||||||| ||||| ||||| ||||||||||||||||   | ||||||| ||| ||||||||  |||||| ||||||    
34389062 gatcacttttgattcgagatcaagagtcagttctttgactcaagttggtttttgggcttt--gtgttgtgctatttcggtggatcgtaggtcgtgaggtt 34388965  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 91
Target Start/End: Complemental strand, 30236185 - 30236125
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    |||| |||||||||||||||||| ||||||| |||||| |||| || | ||||||||||||    
30236185 gatcgcttttgattcgagatcgggagtcagttctttggttcaagtttggttttgggctttt 30236125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #16
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 73
Target Start/End: Complemental strand, 10248610 - 10248568
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaa 73  Q
    ||||||||||||||| ||||||| ||||||| |||||||||||    
10248610 gatcacttttgattcaagatcgggagtcagttctttggctcaa 10248568  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #17
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 31 - 88
Target Start/End: Original strand, 15906710 - 15906767
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggct 88  Q
    |||||| |||||||||||||||| ||||||| |||||| |||| || | |||||||||    
15906710 gatcacatttgattcgagatcgggagtcagttctttggttcaagtttggttttgggct 15906767  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #18
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 30 - 91
Target Start/End: Complemental strand, 32945761 - 32945700
Alignment:
30 tgatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    |||||||||||||||||||||||| ||||| | |||||  |||| || | ||||||||||||    
32945761 tgatcacttttgattcgagatcgggagtcaattctttgattcaagtttggttttgggctttt 32945700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 15)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 31 - 213
Target Start/End: Complemental strand, 27031897 - 27031715
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||  ||||||  ||||||||||| |||||||| ||| ||||||||| ||||||||| |||||||| ||||| ||||||||    
27031897 gatcacttttgattcgagatcgagagtcagctctttggctcaagttggttttagggattttgtttt-gtgctctttcggtggatcggaggttgagaggtt 27031799  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctc-gacttgtcgttgaagtctgggagttttattttgagg 213  Q
    ||||||| ||| |||||||| ||||| |||||||||||||||||||| |  | |  ||||||||||||||||||||||||||||    
27031798 gtggaagctgcatgttcattcggttaagagcttttcgaatgtggctcagtttggatgttgaagtctgggagttttattttgagg 27031715  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 32 - 213
Target Start/End: Original strand, 24658954 - 24659134
Alignment:
32 atcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggttg 131  Q
    |||||||||||||||||||||| ||||||  |||||||| || |||||||||||||||| ||||| ||||||||| |||||||| |||||||||||||||    
24658954 atcacttttgattcgagatcgggagtcagctctttggctgaagttggtttttgggctttggtttt-gtgctctttcggtggatcggaggtcgagaggttg 24659052  T
132 tggaagttgcttgttcattaggttaggagcttttcgaatgtggctc-gacttgtcgttgaagtctgggagttttattttgagg 213  Q
    ||||||   | |||||||| |||||| ||||||||||||||||||| | || |  ||| ||||||||||||||||||||||||    
24659053 tggaagcatcatgttcattcggttagaagcttttcgaatgtggctcagcctgggagtt-aagtctgggagttttattttgagg 24659134  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 31 - 213
Target Start/End: Original strand, 7857677 - 7857859
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| |||||   |||| ||| || ||||||||||| |||||||||| ||||||||| |||||||| | ||||||||||||    
7857677 gatcacttttgattcgagatcgggagtcaactcttttgctgaagttggtttttggccttttgtttt-gtgctctttcggtggatcggtggtcgagaggtt 7857775  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctc-gacttgtcgttgaagtctgggagttttattttgagg 213  Q
    ||||||| ||||||| |||| ||||||||||||||  |||||||||| |  | |  ||||||||||||||||||||||||||||    
7857776 gtggaagctgcttgtccattcggttaggagcttttgaaatgtggctcagtttgggtgttgaagtctgggagttttattttgagg 7857859  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 31 - 213
Target Start/End: Complemental strand, 46814524 - 46814342
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||   |||||||||| ||||||||| |||||||||||| ||||||||| |||||||| || |||||||||||    
46814524 gatcacttttgattcgagatcgggagtcagctttttggctcaagttggttttttggcttttgtttt-gtgctctttcggtggatcggatgtcgagaggtt 46814426  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctcgac-ttgtcgttgaagtctgggagttttattttgagg 213  Q
    |  |||| |||  ||||||| | ||||||||||||||||||||||||| | | |  |||||||| |||||||||||||| ||||    
46814425 gcagaagctgcaagttcattcgattaggagcttttcgaatgtggctcggcgtgggtgttgaagtatgggagttttatttcgagg 46814342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #5
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 31 - 183
Target Start/End: Complemental strand, 24684535 - 24684383
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||||||||| ||||||||||||| |||||| ||||| ||| | |||||||||||||||||| ||||||||||||| |||||||| ||||||| ||||||    
24684535 gatcacttttaattcgagatcggatgtcagttctttgactctagttggtttttgggcttttg-ttttgtgctctttcggtggatcggaggtcgcgaggtt 24684437  T
131 gtggaagttgcttgttcattaggttaggagcttttcg-aatgtggctcgacttg 183  Q
    ||||||| ||| || || || ||| ||| ||| |||| |||||||||| |||||    
24684436 gtggaagatgcatgatccttcggtcaggtgctcttcgaaatgtggctcaacttg 24684383  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #6
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 24449987 - 24449890
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||||||||||||| |||||||||||||||| ||||| || || |||||||||||| |||   | |||||||||||||||||||| ||||||| ||||||    
24449987 gatcacttttgatttgagatcggaagtcagttctttgtcttaagttggtttttgggattt--gtgttgtgctcttttggtggatcggaggtcgcgaggtt 24449890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #7
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 31 - 130
Target Start/End: Original strand, 41920476 - 41920573
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| ||||| ||||| |||| |||||||||||   | ||||||||||| |||||||| ||||||| ||||||    
41920476 gatcacttttgattcgagatcgggagtcagttctttgactcaagttggattttgggcttt--gtgttgtgctctttcggtggatcggaggtcgcgaggtt 41920573  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #8
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 46692876 - 46692779
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||| ||| ||||||||||| ||||||||||||||||   | ||||||||||| ||||| || ||||||| ||||||    
46692876 gatcacttttgattcgagatcgggagttagttctttggctcaagttggtttttgggcttt--gtgttgtgctctttcggtggttcggaggtcgcgaggtt 46692779  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #9
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 5389478 - 5389381
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| ||||| ||||| || |||||||||||||   | ||||||||||| ||||| || ||||||| ||||||    
5389478 gatcacttttgattcgagatcgggagtcagttctttgactcaagtttgtttttgggcttt--gtgttgtgctctttcggtggttcggaggtcgcgaggtt 5389381  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #10
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 31585817 - 31585720
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| ||||| ||||| ||||||||||||||||   | ||||||| ||| ||||| || ||||||| ||||||    
31585817 gatcacttttgattcgagatcgggagtcagttctttgactcaagttggtttttgggcttt--gtgttgtgctatttcggtgggtcggaggtcgcgaggtt 31585720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #11
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 102 - 177
Target Start/End: Complemental strand, 31291008 - 31290933
Alignment:
102 tcttttggtggatcagaggtcgagaggttgtggaagttgcttgttcattaggttaggagcttttcgaatgtggctc 177  Q
    ||||| |||||||| ||||||||||||| |||||||||||||| || || || ||||||||||||| |||||||||    
31291008 tctttcggtggatcggaggtcgagaggtggtggaagttgcttgatctttcggataggagcttttcggatgtggctc 31290933  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #12
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 130
Target Start/End: Complemental strand, 30685961 - 30685864
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    |||||||||||||| |||||||| ||||||| ||||| ||||| |||| |||||||||||   | ||||||||||| ||||| || ||||||| ||||||    
30685961 gatcacttttgatttgagatcgggagtcagttctttgactcaagttggcttttgggcttt--gtgttgtgctctttcggtggttcggaggtcgcgaggtt 30685864  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #13
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 27102215 - 27102275
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||||||||||||||||||||| ||||||| |||||| |||| || | ||||||||||||    
27102215 gatcacttttgattcgagatcgggagtcagttctttggatcaagtttggttttgggctttt 27102275  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 32 - 135
Target Start/End: Complemental strand, 32864617 - 32864517
Alignment:
32 atcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggttg 131  Q
    ||||||||| ||||||||||||||||| || ||||| ||||| || | ||||||||||   ||| ||   |||||| ||||||||||||||| ||||| |    
32864617 atcacttttaattcgagatcggaagtcggttctttgactcaagtttggttttgggctt---tttatggtttctttttgtggatcagaggtcgggaggtgg 32864521  T
132 tgga 135  Q
    ||||    
32864520 tgga 32864517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #15
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 30 - 70
Target Start/End: Complemental strand, 9313347 - 9313307
Alignment:
30 tgatcacttttgattcgagatcggaagtcagtactttggct 70  Q
    |||||||||||||||||||||||| ||||||| ||||||||    
9313347 tgatcacttttgattcgagatcgggagtcagttctttggct 9313307  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 57; Significance: 6e-24; HSPs: 13)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 30 - 213
Target Start/End: Original strand, 29087504 - 29087687
Alignment:
30 tgatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggt 129  Q
    ||||| |||||||||||||||| | ||||||| |||||  |||||||||||| |||||||||| ||||||||||||| |||||||| ||||||| |||||    
29087504 tgatcccttttgattcgagatcaggagtcagttctttgaatcaaattggtttctgggcttttg-ttttgtgctctttcggtggatcggaggtcgcgaggt 29087602  T
130 tgtggaagttgcttgttcattaggttaggagcttttcgaatgtggctcgactt-gtcgttgaagtctgggagttttattttgagg 213  Q
    | ||| || | | || || || ||| ||| ||| |||| ||||||||| |||| |  ||||  ||||||||| ||||||||||||    
29087603 tatggtagctccatgatcctttggtcaggtgctcttcgtatgtggctcaacttagatgttggggtctgggagctttattttgagg 29087687  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 31 - 130
Target Start/End: Original strand, 34378122 - 34378219
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| ||||| | ||| ||||||||||||||||   ||||||||||||| |||||| | ||||||| ||||||    
34378122 gatcacttttgattcgagatcgggagtcagttctttgacacaagttggtttttgggcttt--gttttgtgctctttcggtggaccggaggtcgcgaggtt 34378219  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 91
Target Start/End: Complemental strand, 13954291 - 13954231
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||||||||||||||||||||| ||||| ||||||||||||| || | ||||||||||||    
13954291 gatcacttttgattcgagatcgggagtcattactttggctcaagtttggttttgggctttt 13954231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 37 - 178
Target Start/End: Original strand, 8297498 - 8297636
Alignment:
37 ttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggttgtggaa 136  Q
    ||||||||||||||||| ||||||| ||||||||||| || | |||||| |||   ||| ||   ||||| |||| ||| ||||||| ||||| ||||||    
8297498 ttttgattcgagatcgggagtcagttctttggctcaagtttggttttggactt---tttatggtttctttcggtgaatcggaggtcgtgaggtggtggaa 8297594  T
137 gttgcttgttcattaggttaggagcttttcgaatgtggctcg 178  Q
    ||||  || || || || ||||||||||||| ||||||||||    
8297595 gttgaatggtctttcggataggagcttttcggatgtggctcg 8297636  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 55 - 137
Target Start/End: Complemental strand, 7162350 - 7162269
Alignment:
55 agtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggttgtggaag 137  Q
    ||||||| ||||| ||||| |||||||||||| ||||| ||||||||||||| | |||||| ||||||| |||||| ||||||    
7162350 agtcagttctttgactcaagttggtttttgggtttttg-ttttgtgctctttcgatggatcggaggtcgcgaggttatggaag 7162269  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 31 - 89
Target Start/End: Original strand, 18593267 - 18593325
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctt 89  Q
    ||||||||||||||||||||||| ||| ||| ||||| ||||| |||||||||||||||    
18593267 gatcacttttgattcgagatcgggagttagttctttgactcaagttggtttttgggctt 18593325  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 31 - 137
Target Start/End: Complemental strand, 7195296 - 7195194
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||||||| ||||||||||| || |  ||||||||||| |  ||    | ||| |||||||| |||||||||||||     
7195296 gatcacttttgattcgagatcgggagtcagttctttggctcaagttagagtttgggcttttatggtt----tttttcggtggatcggaggtcgagaggtc 7195201  T
131 gtggaag 137  Q
    |||||||    
7195200 gtggaag 7195194  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #8
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 31 - 137
Target Start/End: Complemental strand, 39184244 - 39184139
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaa--attggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagagg 128  Q
    ||||||||||||||||||||||||||||||| |||||| ||||  ||| | ||||| ||||   |||| ||| ||||| |||||| ||||||| | ||||    
39184244 gatcacttttgattcgagatcggaagtcagttctttggttcaagcatttggttttgagctt---ttttggtgttctttcggtggaccagaggttgtgagg 39184148  T
129 ttgtggaag 137  Q
    | |||||||    
39184147 tagtggaag 39184139  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #9
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 37 - 90
Target Start/End: Complemental strand, 22675375 - 22675322
Alignment:
37 ttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttt 90  Q
    ||||||||||||||||| ||||||| ||||||||||| || | |||||||||||    
22675375 ttttgattcgagatcgggagtcagttctttggctcaagtttggttttgggcttt 22675322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 31 - 90
Target Start/End: Original strand, 698385 - 698444
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttt 90  Q
    |||| |||||||||||||||||| |||||   ||||| ||||| ||||||||||||||||    
698385 gatctcttttgattcgagatcgggagtcaactctttgactcaagttggtttttgggcttt 698444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #11
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 69
Target Start/End: Complemental strand, 7392088 - 7392050
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggc 69  Q
    ||||||||||||||||||||||| ||||||| |||||||    
7392088 gatcacttttgattcgagatcgggagtcagttctttggc 7392050  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #12
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 37 - 91
Target Start/End: Original strand, 27713099 - 27713153
Alignment:
37 ttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||||||||||||||| | ||||| ||||||||||| || | ||||||||||||    
27713099 ttttgattcgagatcgggaatcagttctttggctcaagtttggttttgggctttt 27713153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #13
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 91
Target Start/End: Complemental strand, 26046021 - 26045961
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||||||||||||||||||||| ||| |||  |||||||||| || | |||||| |||||    
26046021 gatcacttttgattcgagatcgggagttagtgttttggctcaagtttggttttggactttt 26045961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 50; Significance: 8e-20; HSPs: 4)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 31 - 182
Target Start/End: Complemental strand, 20701860 - 20701712
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||||||||||| ||| ||| |||||||| || || | ||||||||||||   | ||   ||||| |||||||| |||||||||||||     
20701860 gatcacttttgattcgagatcgggagttagttctttggcttaagtttggttttgggctttt---tatggtttctttcggtggatcggaggtcgagaggta 20701764  T
131 gtggaagttgcttgttcattaggttaggagcttttcgaatgtggctcgactt 182  Q
    ||||||| ||  || || || || ||||||||||||||||||||||| ||||    
20701763 gtggaagctgaatgatctttcggataggagcttttcgaatgtggctcaactt 20701712  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 130
Target Start/End: Original strand, 3117517 - 3117614
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagaggtt 130  Q
    ||||||||||||||| ||||||| ||||||| ||||| ||||| ||||||||||||||||   | |||||||||||  |||| || ||||||| ||||||    
3117517 gatcacttttgattcaagatcgggagtcagttctttgactcaagttggtttttgggcttt--gtgttgtgctctttatgtggttcggaggtcgcgaggtt 3117614  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 30 - 91
Target Start/End: Original strand, 9224064 - 9224125
Alignment:
30 tgatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||| |||||||||||||||||| ||||||| |||||| |||  || | ||||||||||||    
9224064 tgatcgcttttgattcgagatcgggagtcagttctttggttcagttttggttttgggctttt 9224125  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 31 - 91
Target Start/End: Complemental strand, 26216076 - 26216016
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||||||||||||||||||||| ||||||| ||| || |||  || | ||||||||||||    
26216076 gatcacttttgattcgagatcgggagtcagttcttcggttcagttttggttttgggctttt 26216016  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0200 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: scaffold0200
Description:

Target: scaffold0200; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 31 - 91
Target Start/End: Original strand, 19407 - 19467
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||||||||||||||||||||||||||||| ||||||||||| || | ||||||||||||    
19407 gatcacttttgattcgagatcggaagtcagttctttggctcaagtttggttttgggctttt 19467  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0119 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0119
Description:

Target: scaffold0119; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 31 - 91
Target Start/End: Complemental strand, 42195 - 42135
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggctttt 91  Q
    ||||||||||||||||||||||||||||||| ||||||||||| || | ||||||| ||||    
42195 gatcacttttgattcgagatcggaagtcagttctttggctcaagtttggttttgggatttt 42135  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0050 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0050
Description:

Target: scaffold0050; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 30 - 177
Target Start/End: Original strand, 36730 - 36876
Alignment:
30 tgatcacttttgattcgagatcggaagtcagtactttggctcaaattggt--ttttgggcttttgtttttgtgctcttttggtggatcagaggtcgagag 127  Q
    |||||||||||||||||||||||| ||||||| ||||| ||||| ||  |  |||||| |||||   | ||   ||||| |||||||| ||||||||||     
36730 tgatcacttttgattcgagatcgggagtcagttctttgtctcaactttttggttttggtctttt---tatgatttctttcggtggatcggaggtcgagat 36826  T
128 gttgtggaagttgcttgttcattaggttaggagcttttcgaatgtggctc 177  Q
    || ||||||||||  || || || ||||||||||||||||| ||||||||    
36827 gtggtggaagttgaatggtctttcggttaggagcttttcgattgtggctc 36876  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0068 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: scaffold0068
Description:

Target: scaffold0068; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 31 - 122
Target Start/End: Complemental strand, 35828 - 35740
Alignment:
31 gatcacttttgattcgagatcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtc 122  Q
    ||||||||||||||||||||||| ||||| | ||||| || || ||||||||||||||||   | ||||||||||| |||||||| ||||||    
35828 gatcacttttgattcgagatcgggagtca-ttctttgacttaagttggtttttgggcttt--atgttgtgctctttcggtggatcggaggtc 35740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0343 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: scaffold0343
Description:

Target: scaffold0343; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 49 - 123
Target Start/End: Original strand, 5747 - 5820
Alignment:
49 atcggaagtcagtactttggctcaaattggtttttgggcttttgtttttgtgctcttttggtggatcagaggtcg 123  Q
    ||||| ||||||| ||||| ||||  |||||||||||||||| ||||||||||||||| ||| |||| |||||||    
5747 atcgggagtcagttctttgactcaggttggtttttgggcttt-gtttttgtgctctttcggtagatcggaggtcg 5820  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University