View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0629_high_5 (Length: 250)
Name: NF0629_high_5
Description: NF0629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0629_high_5 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 144; Significance: 8e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 144; E-Value: 8e-76
Query Start/End: Original strand, 29 - 250
Target Start/End: Complemental strand, 9828680 - 9828463
Alignment:
| Q |
29 |
attacgaatgctttttaaaacctctctttacctcaattctcaaatatgagtcgttttagttttagtggaaagagcgccccttataattttacttggtttg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9828680 |
attacgaatgctttttaaaacctctctttacctcaattctcaaatacgagtcattttagttttagtggaaagagcgccccttataattatacttggtttg |
9828581 |
T |
 |
| Q |
129 |
tgga-ttagtatcatttatagttctctcaatattttctaataagatttgatttgttgttnnnnnnnnnnnnnntcaatcgatcccatgttagtgcctcta |
227 |
Q |
| |
|
|||| ||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
9828580 |
tggatttagtatcatttatacttttctcaatattttctaataagatttgatttgttgtt-----aaaaaaaaatcaatcgatcacatgttagtgcctcta |
9828486 |
T |
 |
| Q |
228 |
atttaatcttgcgttacttattt |
250 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
9828485 |
atttaatcttgcgttacttattt |
9828463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University