View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0629_low_8 (Length: 281)
Name: NF0629_low_8
Description: NF0629
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0629_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 35 - 102
Target Start/End: Original strand, 19262680 - 19262747
Alignment:
| Q |
35 |
gacatgagacttaacagggtctggcttaacagggacaagaggctttataggggcaggcttagtgggga |
102 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
19262680 |
gacaggagacttaacagggtctggcttaacagggacaataggctttataggggcaggcttagtgggga |
19262747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University