View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0631_high_12 (Length: 345)
Name: NF0631_high_12
Description: NF0631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0631_high_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 5e-78; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 95 - 336
Target Start/End: Complemental strand, 40752579 - 40752320
Alignment:
| Q |
95 |
gcaataatattaattaaagctttattattaattgatttagtttggggagtgcttgctgctgtt------------------cttggggtgaccttctgtg |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
40752579 |
gcaataatattaattaaagctttattattaattgattttgtttggggagtgcttgctgctgttagctgatcttatgctgttcttggggtgaccttctttg |
40752480 |
T |
|
| Q |
177 |
cacgtttcatgctgctgtcttttaatcccagggaggttctgttatagaggagggagnnnnnnnnnnnnnnngtgggctatgttttggataggctatgtct |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40752479 |
cacgtttcatgctgctgtcttttaatcccagggaggttctgttatagaggagggagtttttttctttttttgtgggctatgttttggataggctatgtct |
40752380 |
T |
|
| Q |
277 |
gctgtcttcaaattcatagtgaaattaatatagttgatttttgatctcttcaattcatct |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40752379 |
gctgtcttcaaattcatagtgaaattaatatagttgatttttgatctcttcaattcatct |
40752320 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 973 times since January 2019
Visitors: 4105