View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0631_high_18 (Length: 287)

Name: NF0631_high_18
Description: NF0631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0631_high_18
NF0631_high_18
[»] chr2 (1 HSPs)
chr2 (26-234)||(41508734-41508942)


Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 26 - 234
Target Start/End: Original strand, 41508734 - 41508942
Alignment:
26 agagagggttttctttaagtggttgaaatgagaatcttccaagaaaaggagcaacacaagtgccatgaaatgcattctcaggacaatcattaacatacat 125  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41508734 agagagggttttctttaagtggttgaaatgagaaccttccaagaaaaggagcaacacaagtgccatgaaatgcattctcaggacaatcattaacatacat 41508833  T
126 tgtaaaaatgaaaacaacaacgttggcaaacacaaaagttggaataagccatggaacccattgcttaaagagcctgaaatcacgatcacgagtgacggga 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
41508834 tgtaaaaatgaaaacaacaacgttggcaaacacaaaagttggaataagccatggaacccattgcttaaagagcctgaaatcacgatcacgagtgacggga 41508933  T
226 ggattcgac 234  Q
    |||||||||    
41508934 ggattcgac 41508942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1312 times since January 2019
Visitors: 4114