View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0631_high_19 (Length: 268)
Name: NF0631_high_19
Description: NF0631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0631_high_19 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 30 - 254
Target Start/End: Complemental strand, 6105919 - 6105695
Alignment:
| Q |
30 |
gatacatgttaaagaggctactgatgaattgacttcttgtgatgaacatgaaggtagttcaaagctgcatggtcctgaaaggttattgtcaaccagaaag |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6105919 |
gatacatgttaaagaggctactgatgaattgacttcttgtgatgaacatgaaggtagttcaaagctgcatggtcctgaaaggttattgtcaaccagaaag |
6105820 |
T |
|
| Q |
130 |
gtgaagatattatctcaannnnnnnnggacttaattttgttatttctttatctcattagttcgtttttcttcaggccatttcaccatcttctcaggaaaa |
229 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6105819 |
gtgaagatattatctcaatttttttttgacttaattttgttatttctttttctcattagttcgtttttcttcaggccatttcaccatcttctcaggaaaa |
6105720 |
T |
|
| Q |
230 |
gctctgcaaagccatggagaccatt |
254 |
Q |
| |
|
||||||||| ||||||||||||||| |
|
|
| T |
6105719 |
gctctgcaaggccatggagaccatt |
6105695 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 948 times since January 2019
Visitors: 4105