View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0631_high_20 (Length: 263)
Name: NF0631_high_20
Description: NF0631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0631_high_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 92 - 231
Target Start/End: Complemental strand, 24983107 - 24982968
Alignment:
| Q |
92 |
ttaaccacttaaacttaaccacttggctaataatctattaaaaagaagtaacatcacactttgtcaacttacttgtggattatggcaaacgctaaaacta |
191 |
Q |
| |
|
||||||||||||||| ||||| || || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24983107 |
ttaaccacttaaactcaaccatttcactgataatctattaaaaagaagtaacatcatactttgtcaacttacttgtggattatggcaaacgctaaaacta |
24983008 |
T |
 |
| Q |
192 |
gaaattaaatgaaactggagctgtatttatatgacacaag |
231 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
24983007 |
gaaattaaatgaaaatggagctgtatttatatgacacaag |
24982968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University