View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0631_high_23 (Length: 252)
Name: NF0631_high_23
Description: NF0631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0631_high_23 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 49 - 241
Target Start/End: Complemental strand, 6105558 - 6105366
Alignment:
Q |
49 |
caaataaacccaacaatccggatagacgaaaaatttattgagcaaatttatggttgtatagctatggcctacatgaaaactatcatgatatgaaaaagtg |
148 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6105558 |
caaataaacccaacaatccggatagacgaaaaatttattgagcaaaaatatggttgtatagctatggcctacatgaaaactatcatgatatgaaaaagtg |
6105459 |
T |
 |
Q |
149 |
aaaccttgctactgttgtagtcatggtaatgcttgaaattgccatggactttattgagtgaaaattgttttatttgtactctaatgatttcat |
241 |
Q |
|
|
|||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
6105458 |
aaaccttgctgctgttgtagtcatagtaatgcttgaaattgccatggactttattgagtgagaattgttttatttgtactctaatgatttcat |
6105366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 679 times since January 2019
Visitors: 4098