View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0631_high_26 (Length: 238)
Name: NF0631_high_26
Description: NF0631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0631_high_26 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 41560565 - 41560698
Alignment:
| Q |
1 |
ctgaatggggtttcttcatggtaactttttcctttctatcacttttcctagtagttatccaaatgataaattttcatgcactaagggcacatgttacaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41560565 |
ctgaatggggtttcttcatggtaactttttcctttctatcacttttcctagtagttatccaaatgataaattttcatgcactaagggcacatgttacaga |
41560664 |
T |
|
| Q |
101 |
gatcatgatagaaattttgtgtgaatagtcatgc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
41560665 |
gatcatgatagaaattttgtgtgaatagtcatgc |
41560698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 41555913 - 41555949
Alignment:
| Q |
1 |
ctgaatggggtttcttcatggtaactttttcctttcta |
38 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
41555913 |
ctgaatggggtttcttcatggtaac-ttttcctttcta |
41555949 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 596 times since January 2019
Visitors: 4091