View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0631_low_14 (Length: 354)
Name: NF0631_low_14
Description: NF0631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0631_low_14 |
 |  |
|
[»] scaffold0004 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 227; Significance: 1e-125; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 38 - 344
Target Start/End: Complemental strand, 883897 - 883591
Alignment:
Q |
38 |
atgaatctatcattcatcattttctgaaagtgaagattgaatgaagcgattccaacaaagacgatgattgatttggtttcattctcaaactcaaattttg |
137 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| | |
|
|
T |
883897 |
atgaatctatcattcatcattttctgaaagtggagattgaatgaagcgattcccacaatgacgatgattgatttagtttcattctcaaactcaaatttcg |
883798 |
T |
 |
Q |
138 |
atccaaagaaatggatcaacacagcatgtcacagtcgacactctcaacacctgatcgatttggagatgaaactccaaatgcttttcgaagaaatctccgc |
237 |
Q |
|
|
| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
T |
883797 |
acccaaagaaatggatcaacacagcatgtaacagtcgacactctcaacacctgatcgatttggagatgaaactccaaatgctttccgaggaaatctccgc |
883698 |
T |
 |
Q |
238 |
ttctcttgaggaacaatcttccgctgctctccttcgtattcctcgcgcgacgagagatgttgttcgccttcgtgatgatgctggttctctccgttctgct |
337 |
Q |
|
|
||||||||||||||||||||| ||||||||||| || |||||||||| || |||||||| || ||||||||||||| |||||||||||| |||||||| |
|
|
T |
883697 |
ttctcttgaggaacaatcttctgctgctctcctccgagttcctcgcgccactagagatgtcatttgccttcgtgatgacgctggttctctctgttctgct |
883598 |
T |
 |
Q |
338 |
gtctctg |
344 |
Q |
|
|
||||||| |
|
|
T |
883597 |
gtctctg |
883591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 83 - 344
Target Start/End: Complemental strand, 853671 - 853395
Alignment:
Q |
83 |
gcgattccaacaaagacgatgattgatttggtttcattctcaaactcaaattttgatccaaagaaatggatcaacacagcatgtcacagtcgacactctc |
182 |
Q |
|
|
|||||||| ||||||| |||| | ||||||||| |||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
853671 |
gcgattcccacaaagatgatggtagatttggttcaattctcaaactcaaatttcgacccaaagaaatggatcaacacagcatgtcacagtcgacactctc |
853572 |
T |
 |
Q |
183 |
aaca---------------cctgatcgatttggagatgaaactccaaatgcttttcgaagaaatctccgcttctcttgaggaacaatcttccgctgctct |
267 |
Q |
|
|
|||| ||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
853571 |
aacagtcattagacaaacacctgatcgatttggagatgaaactccagatgctttccgaagaaatctccgcttctcttgaggaacaatcttctgctgctct |
853472 |
T |
 |
Q |
268 |
ccttcgtattcctcgcgcgacgagagatgttgttcgccttcgtgatgatgctggttctctccgttctgctgtctctg |
344 |
Q |
|
|
||| | | ||||||| || || |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
T |
853471 |
cctccatgttcctcgtgccaccagagatgttgttcgtcttcgtgatgatgctggttctctccgttctgctgtctctg |
853395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0004 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0004
Description:
Target: scaffold0004; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 183 - 342
Target Start/End: Complemental strand, 239795 - 239636
Alignment:
Q |
183 |
aacacctgatcgatttggagatgaaactccaaatgcttttcgaagaaatctccgcttctcttgaggaacaatcttccgctgctctccttcgtattcctcg |
282 |
Q |
|
|
|||| ||| ||||||| |||||||||||||| ||| ||| ||| |||||| ||||||||||||| |||||| |||| || ||||| ||| | ||||| |
|
|
T |
239795 |
aacatctggtcgatttagagatgaaactccagatggtttccgaggaaatcgccgcttctcttgaagaacaaagcgccgccgcactcctccgtgtccctcg |
239696 |
T |
 |
Q |
283 |
cgcgacgagagatgttgttcgccttcgtgatgatgctggttctctccgttctgctgtctc |
342 |
Q |
|
|
||| || | ||||| | || || |||||||| || | ||||||||||||||||||||| |
|
|
T |
239695 |
cgccactcgtgatgtcatccgtctccgtgatgacgccgtttctctccgttctgctgtctc |
239636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 882 times since January 2019
Visitors: 4101