View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0631_low_20 (Length: 323)

Name: NF0631_low_20
Description: NF0631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0631_low_20
NF0631_low_20
[»] chr5 (2 HSPs)
chr5 (96-226)||(30980800-30980930)
chr5 (25-67)||(30980718-30980760)


Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 96 - 226
Target Start/End: Original strand, 30980800 - 30980930
Alignment:
96 aagcacacttttttgttattaatatcgagtcgtcaagtgcatgaagatttaacctgttggtgtcaattaagcgatgtgccgacttttatttagatggtgt 195  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||    
30980800 aagcacacttttttgttattaatatcgagtcgtcaagtgcatgaagatttaacctgttggtgtcaattaagcgatgtgccgacttttgtttagatggtgt 30980899  T
196 gcgaactcttgttgctctctatccagataat 226  Q
    |||||||||||||||||||||||||||||||    
30980900 gcgaactcttgttgctctctatccagataat 30980930  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 25 - 67
Target Start/End: Original strand, 30980718 - 30980760
Alignment:
25 attgatgactattcttgctaatagtgtatattgcacactcttt 67  Q
    ||||||||| |||||||||||||||||||||||||||||||||    
30980718 attgatgacaattcttgctaatagtgtatattgcacactcttt 30980760  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University