View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0631_low_21 (Length: 320)
Name: NF0631_low_21
Description: NF0631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0631_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 93 - 223
Target Start/End: Original strand, 30980800 - 30980930
Alignment:
| Q |
93 |
aagcacacttttttgttattaatatcgagtcgtcaagtgcatgaagatttaacctgttggtgtcaattaagcgatgtgccgacttttatttagatggtgt |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
30980800 |
aagcacacttttttgttattaatatcgagtcgtcaagtgcatgaagatttaacctgttggtgtcaattaagcgatgtgccgacttttgtttagatggtgt |
30980899 |
T |
 |
| Q |
193 |
gcgaactcttgttgctctctatccagataat |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
30980900 |
gcgaactcttgttgctctctatccagataat |
30980930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 22 - 64
Target Start/End: Original strand, 30980718 - 30980760
Alignment:
| Q |
22 |
attgatgactattcttgctaatagtgtatattgcacactcttt |
64 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30980718 |
attgatgacaattcttgctaatagtgtatattgcacactcttt |
30980760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University