View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0631_low_27 (Length: 287)
Name: NF0631_low_27
Description: NF0631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0631_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 26 - 234
Target Start/End: Original strand, 41508734 - 41508942
Alignment:
| Q |
26 |
agagagggttttctttaagtggttgaaatgagaatcttccaagaaaaggagcaacacaagtgccatgaaatgcattctcaggacaatcattaacatacat |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41508734 |
agagagggttttctttaagtggttgaaatgagaaccttccaagaaaaggagcaacacaagtgccatgaaatgcattctcaggacaatcattaacatacat |
41508833 |
T |
 |
| Q |
126 |
tgtaaaaatgaaaacaacaacgttggcaaacacaaaagttggaataagccatggaacccattgcttaaagagcctgaaatcacgatcacgagtgacggga |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41508834 |
tgtaaaaatgaaaacaacaacgttggcaaacacaaaagttggaataagccatggaacccattgcttaaagagcctgaaatcacgatcacgagtgacggga |
41508933 |
T |
 |
| Q |
226 |
ggattcgac |
234 |
Q |
| |
|
||||||||| |
|
|
| T |
41508934 |
ggattcgac |
41508942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University