View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0631_low_28 (Length: 286)
Name: NF0631_low_28
Description: NF0631
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0631_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 30 - 282
Target Start/End: Original strand, 37874024 - 37874276
Alignment:
| Q |
30 |
atgaactctgttctgtatatacagcacagccctgcaaatatttacaagcatgtacatggtgataacatgggtggattcatgcaatttctgcatcatattg |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37874024 |
atgaactctgttctgtatatacagcacagccctgcaaatatttacaagcatgtacatggtgataacatgggtggattcatgcaatttctgcatcatattg |
37874123 |
T |
 |
| Q |
130 |
tcaatcaactttgcatcccttgctagcagaaattgccatgcttatgactcagcatgatcattcagtgaaatgtgaactgcaaggctttgactaacatctg |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37874124 |
tcaatcaactttgcatcccttgctagcagaaattgccatgcttatgactcagcatgatcattcagtgaaatgtgaactgcaaggctttgactaacatctg |
37874223 |
T |
 |
| Q |
230 |
atacacagtcagatatttaccagcgagagatcccaggtgcctctgtgctgctc |
282 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
37874224 |
atacatagtcagatatttaccagcgagagatcccaggtgcctctgttctgctc |
37874276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University