View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0632_high_10 (Length: 260)
Name: NF0632_high_10
Description: NF0632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0632_high_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 12 - 231
Target Start/End: Original strand, 31789714 - 31789935
Alignment:
| Q |
12 |
cagagatgacgcaagtaacacagtgaccaaagtagagcaactatcctttctgtttacctcgaatggtttttaggtaatgttggaccacacctatattgag |
111 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789714 |
cagaaatgacgcaagtaacacagtgaccaaagtagagcaactatcctttctgtttacctcgaatggtttttaggtaatgttggaccacacctatattgag |
31789813 |
T |
|
| Q |
112 |
gagcttcaatgg--gnnnnnnngggttgcattgcagctttttgattagtttataactttgatcatgtggctcctactccaaggaagtcaataaatggaat |
209 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31789814 |
gagcttcaatggaaaaaaaaaagggttgcattgcagctttttgattagtttataactttgatcatgtggctcctactccaaggaagtcaataaatggaat |
31789913 |
T |
|
| Q |
210 |
tgcatctgaaggagggggatta |
231 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
31789914 |
tgcatctgaaggagggggatta |
31789935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 527 times since January 2019
Visitors: 4087