View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0632_high_6 (Length: 321)
Name: NF0632_high_6
Description: NF0632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0632_high_6 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 83 - 256
Target Start/End: Complemental strand, 36961011 - 36960838
Alignment:
Q |
83 |
cttctatcttcatcttttgcttcttttgcaacaagtggaatcaatggtaaaataagtggaagtaagaaacaaaacaggaaagttgtggaaccaagtatga |
182 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
36961011 |
cttctatcttcatcttttgcttcttttgcaacaagtggcatcaatggtaaaataagtggaagtaagaaacaaaacaggaaagttgtggaaccaagtatga |
36960912 |
T |
 |
Q |
183 |
ggatagcaccacctagcatcccaaaccctactcagaacaagtgagagtggaatactctctatgatttgctcttc |
256 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
36960911 |
ggatagcaccacctagcatcccaaaccctactcagaacaagtgagagaggaatactctctatgatttgctcttc |
36960838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University