View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0632_high_7 (Length: 313)
Name: NF0632_high_7
Description: NF0632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0632_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 37136252 - 37136469
Alignment:
| Q |
1 |
caattcgatctttactgcacacaaattaactattaacatttgtttatnnnnnnntctttttccgagcacctgaaaatgttttgttattttttcagttgcc |
100 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
37136252 |
caattcgatctttactgcaaacaaattaactattaacatttgtttataaaaaaatctttctccgagcacctgaaaatgttttgttgttttttcagttgcc |
37136351 |
T |
|
| Q |
101 |
cggaagaacagataacgaaatcaaaaacttttggaacacaagaatgaaaaggtgtcaaagagccggcttacctctttatcctccagaaatccgagcagaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
37136352 |
cggaagaacagataacgaaatcaaaaacttttggaacacaagaatgaaaaggcgtcaaagagccggcttacctctttatcctccagaaatccaagcagaa |
37136451 |
T |
|
| Q |
201 |
gctattgcatacaatgat |
218 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
37136452 |
gctattgcatacaatgat |
37136469 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 211 - 240
Target Start/End: Complemental strand, 37136066 - 37136037
Alignment:
| Q |
211 |
acaatgattgaggtcagcttcttgatgatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
37136066 |
acaatgattgaggtcagcttcttgatgatg |
37136037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 465 times since January 2019
Visitors: 4087