View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0632_low_13 (Length: 325)
Name: NF0632_low_13
Description: NF0632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0632_low_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 29 - 291
Target Start/End: Original strand, 3993091 - 3993353
Alignment:
| Q |
29 |
acttatgatgacgttgtgcatgcatcaatttgggtagggaacagaaatgaatgatattggtgggactaaacttttctacttttaagttgtcaaatctgag |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3993091 |
acttatgatgacgttgtgcatgcatcaatttgggtagggaacagaaatgaatgatattggtgggactaaacttttctacttttaagttgtcaaatctgag |
3993190 |
T |
|
| Q |
129 |
atgaaggacaagacaaacattcggaattggccatgtggcgggtctatgacgactagatttgtagcacgaaatgacaatgctgctaataaatgaaagaagc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3993191 |
atgaaggacaagacaaacattcggaattggccatgtggcgggtctatgacgactagatttgtagcacgaaatgacaatgctgctaataaatgaaagaagc |
3993290 |
T |
|
| Q |
229 |
atttgatttgagtcatcagagtcatataacggcatgaagccaaatttgggatgtgcccacaac |
291 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3993291 |
atttgatttgagtcaccagagtcatataacggcatgaagccaaacttgggatgtgcccacaac |
3993353 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 530 times since January 2019
Visitors: 4087