View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0632_low_14 (Length: 321)

Name: NF0632_low_14
Description: NF0632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0632_low_14
NF0632_low_14
[»] chr7 (1 HSPs)
chr7 (83-256)||(36960838-36961011)


Alignment Details
Target: chr7 (Bit Score: 166; Significance: 8e-89; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 166; E-Value: 8e-89
Query Start/End: Original strand, 83 - 256
Target Start/End: Complemental strand, 36961011 - 36960838
Alignment:
83 cttctatcttcatcttttgcttcttttgcaacaagtggaatcaatggtaaaataagtggaagtaagaaacaaaacaggaaagttgtggaaccaagtatga 182  Q
    |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36961011 cttctatcttcatcttttgcttcttttgcaacaagtggcatcaatggtaaaataagtggaagtaagaaacaaaacaggaaagttgtggaaccaagtatga 36960912  T
183 ggatagcaccacctagcatcccaaaccctactcagaacaagtgagagtggaatactctctatgatttgctcttc 256  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||    
36960911 ggatagcaccacctagcatcccaaaccctactcagaacaagtgagagaggaatactctctatgatttgctcttc 36960838  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 552 times since January 2019
Visitors: 4087