View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0632_low_15 (Length: 313)

Name: NF0632_low_15
Description: NF0632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0632_low_15
NF0632_low_15
[»] chr2 (2 HSPs)
chr2 (1-218)||(37136252-37136469)
chr2 (211-240)||(37136037-37136066)


Alignment Details
Target: chr2 (Bit Score: 177; Significance: 2e-95; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 1 - 218
Target Start/End: Original strand, 37136252 - 37136469
Alignment:
1 caattcgatctttactgcacacaaattaactattaacatttgtttatnnnnnnntctttttccgagcacctgaaaatgttttgttattttttcagttgcc 100  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||       ||||| ||||||||||||||||||||||||| ||||||||||||||    
37136252 caattcgatctttactgcaaacaaattaactattaacatttgtttataaaaaaatctttctccgagcacctgaaaatgttttgttgttttttcagttgcc 37136351  T
101 cggaagaacagataacgaaatcaaaaacttttggaacacaagaatgaaaaggtgtcaaagagccggcttacctctttatcctccagaaatccgagcagaa 200  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||    
37136352 cggaagaacagataacgaaatcaaaaacttttggaacacaagaatgaaaaggcgtcaaagagccggcttacctctttatcctccagaaatccaagcagaa 37136451  T
201 gctattgcatacaatgat 218  Q
    ||||||||||||||||||    
37136452 gctattgcatacaatgat 37136469  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 211 - 240
Target Start/End: Complemental strand, 37136066 - 37136037
Alignment:
211 acaatgattgaggtcagcttcttgatgatg 240  Q
    ||||||||||||||||||||||||||||||    
37136066 acaatgattgaggtcagcttcttgatgatg 37136037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 485 times since January 2019
Visitors: 4087