View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0632_low_19 (Length: 269)
Name: NF0632_low_19
Description: NF0632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0632_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 19 - 240
Target Start/End: Original strand, 30671172 - 30671396
Alignment:
| Q |
19 |
atgaaatagaaaattaacctttccaccataatcaaatggaaattgtgaaaaaagactaaacgtaccgattgggtgcaacataattccacttttcgcattc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30671172 |
atgaaatagaaaattaacctttccaccataatcaaatggaaattgtgaaaaaagactaaatgtaccgattgggtgcaacataattccacttttcgcattc |
30671271 |
T |
 |
| Q |
119 |
agcaattcaacatactaaaggtagagagaaagctata---cctcttaagttgacattaaggaccaactttaccttcataaaattggacttggtaacaaac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30671272 |
agcaattcaacatactaaaggtagagagaaagctatactccctcttaagttgacattaaggaccaactttaccttcataaaattggacttggtaacaaac |
30671371 |
T |
 |
| Q |
216 |
gataatctaatttgtttttgctaag |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
30671372 |
gataatctaatttgtttttgctaag |
30671396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University