View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0632_low_22 (Length: 253)
Name: NF0632_low_22
Description: NF0632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0632_low_22 |
 |  |
|
[»] scaffold0147 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 29 - 253
Target Start/End: Complemental strand, 17935 - 17711
Alignment:
Q |
29 |
tgtgttaattagaaaaggactttatagtgctattttattttccttacaaataatgggtaacataaatgataactttgaaaatttcaatagattgtagatg |
128 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
17935 |
tgtgttaattagaaaaggactttatagtgctattttattttacttacaaataatgggtaacataaatgataactttgaaactttcaatagattgtagatg |
17836 |
T |
 |
Q |
129 |
aagcacatgctgtcgtgttagtagggggaacacttcagccaatagaagagacaagggagagactctttccatggttaccaccaaataagttgcatttctt |
228 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
17835 |
aagcacatgctgtcgtgttagtagggggaacacttcagccaatagaagagacaagggagagactctttccatggttaccaccaaataagttgcatttctt |
17736 |
T |
 |
Q |
229 |
ttcttgtggtcatattgtccctcca |
253 |
Q |
|
|
||||||||||||||||||||||||| |
|
|
T |
17735 |
ttcttgtggtcatattgtccctcca |
17711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 515 times since January 2019
Visitors: 4087