View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0632_low_23 (Length: 242)

Name: NF0632_low_23
Description: NF0632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0632_low_23
NF0632_low_23
[»] chr2 (1 HSPs)
chr2 (104-206)||(7806315-7806417)


Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 104 - 206
Target Start/End: Original strand, 7806315 - 7806417
Alignment:
104 acaaaaattaatcttaattcaataattttcttcttcaatttatattcgtttataattttagtttagttgtatgtaatacttagttcaattgataaatatt 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7806315 acaaaaattaatcttaattcaataattttcttcttcaatttatattcgtttataattttagtttagttgtatgtaatacttagttcaattgataaatatt 7806414  T
204 gat 206  Q
    |||    
7806415 gat 7806417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University