View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0632_low_23 (Length: 242)
Name: NF0632_low_23
Description: NF0632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0632_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 103; Significance: 2e-51; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 104 - 206
Target Start/End: Original strand, 7806315 - 7806417
Alignment:
| Q |
104 |
acaaaaattaatcttaattcaataattttcttcttcaatttatattcgtttataattttagtttagttgtatgtaatacttagttcaattgataaatatt |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7806315 |
acaaaaattaatcttaattcaataattttcttcttcaatttatattcgtttataattttagtttagttgtatgtaatacttagttcaattgataaatatt |
7806414 |
T |
|
| Q |
204 |
gat |
206 |
Q |
| |
|
||| |
|
|
| T |
7806415 |
gat |
7806417 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 412 times since January 2019
Visitors: 4084