View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0632_low_6 (Length: 385)
Name: NF0632_low_6
Description: NF0632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0632_low_6 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 97 - 385
Target Start/End: Original strand, 34451899 - 34452188
Alignment:
Q |
97 |
acaatagttttgtagctttagtttgttgcattgcattgtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgtc |
196 |
Q |
|
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34451899 |
acaatagttctgtagctttagtttgttgcattgcatggtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgtc |
34451998 |
T |
 |
Q |
197 |
atatgatgggaacagtccaa-aaaagcaacctacagtattaccctttcttctttaattagatctttcatcatcaattcacaaagatcaaacnnnnnnnnn |
295 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
T |
34451999 |
atatgatgggaacagtccaacaaaagcaacctacagtattaccttttcttctttaatcagatctttcatcatcaattcacaaagatcaagcttttttttt |
34452098 |
T |
 |
Q |
296 |
gcatcacaataacatcctttccttgtctcattttattttgtggatgaaatgaatctttaatccttttttcttcaataagcaatgaatctt |
385 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34452099 |
gcatcacaataacatcctttccttgtctcattttattttgtggatgaaatgaatctttaatccttttttcttcaataagcaatgaatctt |
34452188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 482 times since January 2019
Visitors: 4087