View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0632_low_8 (Length: 362)
Name: NF0632_low_8
Description: NF0632
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0632_low_8 |
 | |
|
| [»] scaffold0147 (2 HSPs) |
| | |
|
Alignment Details
Target: scaffold0147 (Bit Score: 219; Significance: 1e-120; HSPs: 2)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 14585 - 14367
Alignment:
| Q |
1 |
tggaatgctctcttctcattgccaactttactatagaatgtggaccatacatctcttgtttttgcaaattaaataagtgcttctgactatagaatgtgtg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14585 |
tggaatgctctcttctcattgccaactttactatagaatgtggaccatacatctcttgtttttgcaaattaaataagtgcttctgactatagaatgtgtg |
14486 |
T |
|
| Q |
101 |
acattaattattttcagtgatacatactgaattttctgttaaaaagaagtgagttgaatctgctttgttggtgcattaattttggatcaaagtctacatg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14485 |
acattaattattttcagtgatacatactgaattttctgttaaaaagaagtgagttgaatctgctttgttggtgcattaattttggatcaaagtctacatg |
14386 |
T |
|
| Q |
201 |
tgttctcatattagaagga |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
14385 |
tgttctcatattagaagga |
14367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0147; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 219 - 259
Target Start/End: Original strand, 17895 - 17935
Alignment:
| Q |
219 |
aaaataaaatagcactataaagtccttttctaattaacaca |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17895 |
aaaataaaatagcactataaagtccttttctaattaacaca |
17935 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 387 times since January 2019
Visitors: 4082