View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0633_low_22 (Length: 313)
Name: NF0633_low_22
Description: NF0633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0633_low_22 |
 | |
|
| [»] scaffold0147 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0147 (Bit Score: 106; Significance: 5e-53; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 134 - 247
Target Start/End: Original strand, 15218 - 15331
Alignment:
| Q |
134 |
atggttaacatatcagagtcacagtgactcactgcaattctgacatacccattgtgatatcaaacatgcacttaaaatctaaattgcttctcggttggac |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
15218 |
atggttaacatatcagagtcacagtgactcactgcaattctgacatacccactgtgatatcaaacatgcacttaaaatctaaattgcttctcgattggac |
15317 |
T |
|
| Q |
234 |
cacatcaatttgat |
247 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
15318 |
cacatcaatttgat |
15331 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University