View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0633_low_23 (Length: 303)
Name: NF0633_low_23
Description: NF0633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0633_low_23 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 5e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 5e-90
Query Start/End: Original strand, 54 - 233
Target Start/End: Original strand, 47533362 - 47533541
Alignment:
Q |
54 |
gagaatcccccggacccaaactaccaactgtgtggaaacatagtcaggtgtttgttttgatatatatacgtagcaactttttcacccaaaaactatgtag |
153 |
Q |
|
|
|||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47533362 |
gagaatcccctggacccaaactaccaactgtgtgggaacatagtcaggtgtttgttttgatatatatacgtagcaactttttcacccaaaaactatgtag |
47533461 |
T |
 |
Q |
154 |
caactttttctctttgagcatgcaccttgtaatgtccatgataatttttatcctcctatcagctagaccatgaggtttat |
233 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
47533462 |
caactttttctctttgagcatgcaccttgtaatgtccatgataatttttatcctcatatcagctagaccatgaggtttat |
47533541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University