View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0633_low_27 (Length: 274)
Name: NF0633_low_27
Description: NF0633
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0633_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 1 - 175
Target Start/End: Complemental strand, 4761502 - 4761328
Alignment:
Q |
1 |
attataatgtaattattaattattatggtttaccaacaaaccccgcctattgatattttctgttacgtaaatggtgagattaacatattgtaacaaacat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4761502 |
attataatgtaattattaattattatggtttaccaataaaccctgcctattgatattttctgttacgtaaatggtgagattaacatattgtaacaaacat |
4761403 |
T |
 |
Q |
101 |
taacaaaaattgttaacaaatctatgcatggtaagatataataagaaaaatggttctggttccacttagtcatga |
175 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
4761402 |
taacaaaaattgttaacaaatctatgcatggtaagatataataagaaaaatgattctggttccacttagtcatga |
4761328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3190 times since January 2019
Visitors: 4030