View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0634_low_5 (Length: 335)
Name: NF0634_low_5
Description: NF0634
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0634_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 243; Significance: 1e-135; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 30 - 321
Target Start/End: Complemental strand, 44574295 - 44573992
Alignment:
| Q |
30 |
ctacatccgtctgtgcaaaagatgtacgtt------------cattctgtcactttctttcgaaatggtgctcttggaagaacaaataataattttgaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||||||||||||| || |
|
|
| T |
44574295 |
ctacatccgtctgtgcaaaagatgtacgttgttgttgttctacattctgtcgctttctttcgaaatgttgctcttggaagaacaaataataattttccaa |
44574196 |
T |
|
| Q |
118 |
cattgaattttcagggaataaatgtaatatgtgtaaagaggggaggggatactcaaatgagcagccatagtgaatggctgctcacggttcctaacaaacc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44574195 |
cattgaattttcagggaataaatgtaatatgtgtaaagaggggaggggatactcaaatgagcagccatagtgaatggctgctcacggttcctaacaaacc |
44574096 |
T |
|
| Q |
218 |
agatgcaattgattttagcttcattcccattacctctcttcttaaaggtgctcctggaaggggattcctctcccatgctatcaacctctatcttcgatgt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44574095 |
agatgcaattgattttagcttcattcccattacctctcttcttaaaggtgcttctggaaggggattcctctcccatgctatcaacctctatcttcgatgt |
44573996 |
T |
|
| Q |
318 |
aagt |
321 |
Q |
| |
|
|||| |
|
|
| T |
44573995 |
aagt |
44573992 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 290 - 322
Target Start/End: Original strand, 39784204 - 39784236
Alignment:
| Q |
290 |
ccatgctatcaacctctatcttcgatgtaagta |
322 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
39784204 |
ccatgctataaacctctatcttcgatgtaagta |
39784236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 290 - 322
Target Start/End: Original strand, 39790712 - 39790744
Alignment:
| Q |
290 |
ccatgctatcaacctctatcttcgatgtaagta |
322 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
39790712 |
ccatgctataaacctctatcttcgatgtaagta |
39790744 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 2770 times since January 2019
Visitors: 4012