View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0635_high_2 (Length: 483)
Name: NF0635_high_2
Description: NF0635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0635_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 322; Significance: 0; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 322; E-Value: 0
Query Start/End: Original strand, 30 - 371
Target Start/End: Complemental strand, 25032315 - 25031974
Alignment:
| Q |
30 |
ctctcgcaggtggcgaaatctctggcagaatctacaagccttcgaattctccgacgactcacacgaagacggcaactggccaataatgttcagaaggttt |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25032315 |
ctctcgcaggtggcgaaatctctggcagaatctacaagccttcgaattctccgacgactcatacgaagacggcaactggccaataatgttcagaaggttt |
25032216 |
T |
 |
| Q |
130 |
gcattcttcgtcaacgccgtgctctccctccatcgatcccgcgatattaaaaggtttagtctcaccagcggcatggtggatgatgactggtttcgtagcg |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| ||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25032215 |
gcattcttcgtcaacgccgtgctctccctccgtcggtcccgtgatattaaaaggtttcgtctcaccagcggcatggtggatgatgactggtttcgtagcg |
25032116 |
T |
 |
| Q |
230 |
actgcttcgacgtatgggttcgtgctgccattgggcctcaacttgaagaactgtttgtttcccttgaatactgcgatgaagaccggcaagtactggttcc |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25032115 |
actgcttcgacgtatgggttcgtgctgccattgggcctcaacttgaagaactgtttgtttcccttgaatactgcgatgaagaccggcaagtactggttcc |
25032016 |
T |
 |
| Q |
330 |
ttcttctctcctgaattgcaccaatctcgtttccctcaggta |
371 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25032015 |
ttcttctctcctgaattgcaccaatctcgtttccctcaggta |
25031974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 434 - 473
Target Start/End: Complemental strand, 25031965 - 25031926
Alignment:
| Q |
434 |
tatggttgctttcatgatttcatctcttgttctctctctg |
473 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25031965 |
tatggttgctttcatgatttcatctcttgttctctctctg |
25031926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 371
Target Start/End: Original strand, 20505315 - 20505354
Alignment:
| Q |
332 |
cttctctcctgaattgcaccaatctcgtttccctcaggta |
371 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20505315 |
cttccctcttgaattgcaccaatctcgtttccctcaggta |
20505354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University