View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0635_low_15 (Length: 259)
Name: NF0635_low_15
Description: NF0635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0635_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 18 - 229
Target Start/End: Complemental strand, 16068217 - 16068006
Alignment:
| Q |
18 |
atgaatgaataaaaaatgaaccctagaaatgaagagggggttttccatggagtttagctcaacaccaagtaacatactatatcaaaaaccaaaccaatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16068217 |
atgaatgaataaaaaatgaaccctagaaatgaagagggggttttccatggagtttagctcaacaccaagtaacatactatatcaaaaaccaaaccaatca |
16068118 |
T |
|
| Q |
118 |
agtaacgaagaaatagaaagttaaggtatatgtgggagaaatgatgggtacgccaacattcttaataggttaaaacatgcatgaccatttgacacaataa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16068117 |
agtaacgaagaaatagaaagttaaggtacatgtgggagaaatgatgggtacgccaacattcttaataggttaaaacatgcatgaccatttgacacaataa |
16068018 |
T |
|
| Q |
218 |
ataaagagctaa |
229 |
Q |
| |
|
|||||||||||| |
|
|
| T |
16068017 |
ataaagagctaa |
16068006 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3289 times since January 2019
Visitors: 4031