View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0635_low_17 (Length: 253)
Name: NF0635_low_17
Description: NF0635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0635_low_17 |
 | |
|
| [»] scaffold0078 (3 HSPs) |
| | |
|
| [»] scaffold0184 (2 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 8e-79; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 16566925 - 16567093
Alignment:
| Q |
1 |
tgttatggaaggggaagaaggtatggcaatgcgtgatagaatgaagagtttaagagaatctgctgctatggcattgaaagttaaagatggttcttcaata |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
16566925 |
tgttatggaaggggaagaaggcatggcaatgcgtgatagaatgaagagtttaagagaagctgctgctatggcattgaatgccaaagatggttcttcaata |
16567024 |
T |
|
| Q |
101 |
caaactatttcacacttggctactcaattggagaagattggtgggatttaggaaaataatattgctctt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16567025 |
caaactatttcacacttggctactcaattggagaagattggtgggatttaggaaaataatattgctctt |
16567093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 1 - 169
Target Start/End: Complemental strand, 16598737 - 16598569
Alignment:
| Q |
1 |
tgttatggaaggggaagaaggtatggcaatgcgtgatagaatgaagagtttaagagaatctgctgctatggcattgaaagttaaagatggttcttcaata |
100 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
16598737 |
tgttatggaaggggaagaaggcatggcaatgcgtgatagaatgaagagtttaagagaagctgctgctatggcattgaatgccaaagatggttcttcaata |
16598638 |
T |
|
| Q |
101 |
caaactatttcacacttggctactcaattggagaagattggtgggatttaggaaaataatattgctctt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16598637 |
caaactatttcacacttggctactcaattggagaagattggtgggatttaggaaaataatattgctctt |
16598569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 129; Significance: 7e-67; HSPs: 3)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 129; E-Value: 7e-67
Query Start/End: Original strand, 1 - 169
Target Start/End: Original strand, 3269 - 3437
Alignment:
| Q |
1 |
tgttatggaaggggaagaaggtatggcaatgcgtgatagaatgaagagtttaagagaatctgctgctatggcattgaaagttaaagatggttcttcaata |
100 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3269 |
tgttatggaaggggaagaaggtattgcaatgcgtgatagaatgaagagtttaagagaatctgctgctatggcattgaaagccaaagatggttcttcaatt |
3368 |
T |
|
| Q |
101 |
caaactatttcacacttggctactcaattggagaagattggtgggatttaggaaaataatattgctctt |
169 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| || |||||| |||||||| |||||| |||||||||| |
|
|
| T |
3369 |
caaactatgtcacacttggctactcaattggaaaacattggtaggatttagaaaaatagtattgctctt |
3437 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 5 - 156
Target Start/End: Original strand, 22527 - 22678
Alignment:
| Q |
5 |
atggaaggggaagaaggtatggcaatgcgtgatagaatgaagagtttaagagaatctgctgctatggcattgaaagttaaagatggttcttcaatacaaa |
104 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||| | |||| ||| ||||||||| || ||||||||||||||||| |||| |
|
|
| T |
22527 |
atggaaggggaagaaggtaaggcaatgcgtgatagaatgaagagtttaagagattatgctactaaggcattgaatgtcaaagatggttcttcaattcaaa |
22626 |
T |
|
| Q |
105 |
ctatttcacacttggctactcaattggagaagattggtgggatttaggaaaa |
156 |
Q |
| |
|
|| | ||||||||||||| |||| |||| | ||||||||||||||||||||| |
|
|
| T |
22627 |
ctctctcacacttggctagtcaaatggaaatgattggtgggatttaggaaaa |
22678 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 152
Target Start/End: Original strand, 57816 - 57960
Alignment:
| Q |
5 |
atggaaggggaagaaggtatggcaatgcgtgatagaatgaagagtttaagagaatctgctgctatggcattgaaagttaaagatggttcttcaatacaaa |
104 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||||||||||||||| ||| | |||||||| ||| | |||| | | ||||||||||||||| | |
|
|
| T |
57816 |
atggaaggggaagaaggtaagagaatgcgtgaaagaatgaagagtttaaaagattatgctgctaatgcacttaaag---atggtggttcttcaatacaga |
57912 |
T |
|
| Q |
105 |
ctatttcacacttggctactcaattggagaagattggtgggatttagg |
152 |
Q |
| |
|
|| | ||||||||||||| ||||| ||| || ||||||||| ||||| |
|
|
| T |
57913 |
ctttgtcacacttggctagtcaatgggaaaattttggtgggacttagg |
57960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0184 (Bit Score: 46; Significance: 2e-17; HSPs: 2)
Name: scaffold0184
Description:
Target: scaffold0184; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 5 - 152
Target Start/End: Complemental strand, 15028 - 14884
Alignment:
| Q |
5 |
atggaaggggaagaaggtatggcaatgcgtgatagaatgaagagtttaagagaatctgctgctatggcattgaaagttaaagatggttcttcaatacaaa |
104 |
Q |
| |
|
||||||||||||||||||| | ||||||||| |||||||||||||||| ||| | |||||||| ||| | |||| | | ||||||||||||||| | |
|
|
| T |
15028 |
atggaaggggaagaaggtaagagaatgcgtgaaagaatgaagagtttaaaagattatgctgctaatgcacttaaag---atggtggttcttcaatacaga |
14932 |
T |
|
| Q |
105 |
ctatttcacacttggctactcaattggagaagattggtgggatttagg |
152 |
Q |
| |
|
|| | ||||||||||||| ||||| ||| || ||||||||| ||||| |
|
|
| T |
14931 |
ctttgtcacacttggctagtcaatgggaaaattttggtgggacttagg |
14884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0184; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 5 - 53
Target Start/End: Original strand, 1886 - 1934
Alignment:
| Q |
5 |
atggaaggggaagaaggtatggcaatgcgtgatagaatgaagagtttaa |
53 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
1886 |
atggaaggggaagaaggtaaaacaatgcgtgatagaatgaagagtttaa |
1934 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3308 times since January 2019
Visitors: 4031