View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0635_low_21 (Length: 249)
Name: NF0635_low_21
Description: NF0635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0635_low_21 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 10 - 249
Target Start/End: Original strand, 45935070 - 45935309
Alignment:
| Q |
10 |
tagctgttgcatagtcaaacttatagtataaaaaatataatttctgatgtttgcatgaattttcttatgggcatcagatgcttttcatgggtaaacgaag |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45935070 |
tagctgttgcatagtcaaacttatagtataaaaaatataatttctgatgtttgcatgaattttcttatgggcatcagatgctttccatgggtaaacgaag |
45935169 |
T |
|
| Q |
110 |
atttggcaccaactttcagctcaagttccgtattctcaaggcacttctgtttcttggcttcttgtcagtaatgatagtgttatttgttgtgtgtgcgctt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
45935170 |
atttggcaccaactttcagctcaagttccgtattctcaaggcacttctatttcttggcttcttgtcagtaatgatagtgttatttgttgtgtgcgcgctt |
45935269 |
T |
|
| Q |
210 |
acggtatcagatttgtttgcttccgttcttgccttcatgc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45935270 |
acggtatcagatttgtttgcttccgttcttgccttcatgc |
45935309 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 15 - 249
Target Start/End: Original strand, 15817303 - 15817538
Alignment:
| Q |
15 |
gttgcatagtcaaacttatagtataaa-aaatataatttctgatgtttgcatgaattttcttatgggcatcagatgcttttcatgggtaaacgaagattt |
113 |
Q |
| |
|
|||||||||| ||| ||| ||||| || |||| |||||||||||||||| ||||| |||| |||||| |||||||| ||| |||||||| |||||||||| |
|
|
| T |
15817303 |
gttgcatagttaaaattacagtatgaataaatctaatttctgatgtttggatgaactttcatatgggtatcagatggtttccatgggtagacgaagattt |
15817402 |
T |
|
| Q |
114 |
ggcaccaactttcagctcaagttccgtattctcaaggcacttctgtttcttggcttcttgtcagtaatgatagtgttatttgttgtgtgtgcgcttacgg |
213 |
Q |
| |
|
|| ||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
15817403 |
ggtaccgactttcagctcatgttccgtattctcaaggcacttctgtttctcggcttcttgtcagtaatggcagtgttatttgttgtgtgtgcgcttacgg |
15817502 |
T |
|
| Q |
214 |
tatcagatttgtttgcttccgttcttgccttcatgc |
249 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
15817503 |
tatcagatttgtttgcttccgttcttgccttcatgc |
15817538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3550 times since January 2019
Visitors: 4037