View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0635_low_22 (Length: 241)
Name: NF0635_low_22
Description: NF0635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0635_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 27231626 - 27231466
Alignment:
Q |
1 |
ccatttggaatcttggaaatttatttgggtttgggttttactatatgcccacatgcacttttctaatacccggattagctaaacaaatttgtcctaaaat |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
T |
27231626 |
ccatttggaatcttggaaatttatttgggttttggttttactatatgcccacatgcacttttctaatacccagattagcgaaacaaatttgtcctaaaat |
27231527 |
T |
 |
Q |
101 |
tatggcannnnnnnnnnnnngattcccaaagtagtatattatatttgttcaactacaccctc |
162 |
Q |
|
|
||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
27231526 |
tatggca-ttttttgtttttgattcccaaagtagtatattatatttgttcaactacaccctc |
27231466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3427 times since January 2019
Visitors: 4035