View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0635_low_22 (Length: 241)

Name: NF0635_low_22
Description: NF0635
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0635_low_22
NF0635_low_22
[»] chr2 (1 HSPs)
chr2 (1-162)||(27231466-27231626)


Alignment Details
Target: chr2 (Bit Score: 106; Significance: 4e-53; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 1 - 162
Target Start/End: Complemental strand, 27231626 - 27231466
Alignment:
1 ccatttggaatcttggaaatttatttgggtttgggttttactatatgcccacatgcacttttctaatacccggattagctaaacaaatttgtcctaaaat 100  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||    
27231626 ccatttggaatcttggaaatttatttgggttttggttttactatatgcccacatgcacttttctaatacccagattagcgaaacaaatttgtcctaaaat 27231527  T
101 tatggcannnnnnnnnnnnngattcccaaagtagtatattatatttgttcaactacaccctc 162  Q
    |||||||             ||||||||||||||||||||||||||||||||||||||||||    
27231526 tatggca-ttttttgtttttgattcccaaagtagtatattatatttgttcaactacaccctc 27231466  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3427 times since January 2019
Visitors: 4035