View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0636_high_5 (Length: 389)
Name: NF0636_high_5
Description: NF0636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0636_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 30 - 380
Target Start/End: Complemental strand, 7406303 - 7405953
Alignment:
| Q |
30 |
attgtccaccttgtgattagaccaaaacacttatgtttgagtaggccctggcttagacattgcaatgacaacatcccatacatatattgcatattttcaa |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7406303 |
attgtccaccttgtgattagaccaaaacacttatgtttgagtaggccctggcttagacattgcaatgacaacatcccatacatatattgcatattttcaa |
7406204 |
T |
 |
| Q |
130 |
tgtgaatatgttctgctgctactgcaaaggtgagtgacgaaaataaggaaacataaataatgatcattagcatatagaacacattatattggtgtttggt |
229 |
Q |
| |
|
||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7406203 |
tgtgaatatgttcagctgctactgcaaagatgagtgacgaaaataaggaaacataaacaatgatcattagcatatagaacacattatattggtgtttggt |
7406104 |
T |
 |
| Q |
230 |
agatgcttgaattgaactcattttagtccaacttattggcaacaaatattcaagtcacaatttcacattcttaccttttgctattgctacccattgagac |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||||| |
|
|
| T |
7406103 |
agatgcttgaattgaactcattttagtccaacttattggcaacaaatattcaagtcacaatttcacattcataccttttgctattgccacccattgagac |
7406004 |
T |
 |
| Q |
330 |
gaaatccttgtgcattctttcccatgttgaatcatatatgtggatattctt |
380 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7406003 |
gaaatccttgtgcattctttcccatgttgaatcatatatgtggattttctt |
7405953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University