View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0636_high_8 (Length: 360)
Name: NF0636_high_8
Description: NF0636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0636_high_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 30 - 210
Target Start/End: Original strand, 46885569 - 46885749
Alignment:
Q |
30 |
gaatcaagatcatcaacaacaagatgcttataataacatgtatccaccaaccatgatgtatggtgaaccatcttcatccacgaattccacgatgcagcat |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
46885569 |
gaatcaagatcatcaacaacaagatgcttataataacatgtatccaccaaccatgacgtatggtgaaccatcttcatccatgaattccacgatgcagcat |
46885668 |
T |
 |
Q |
130 |
gactccaatctggttgatcctaagcccatctacaacgatgggtacgtctataattggtggagtaccaattaacaactttaa |
210 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
46885669 |
gactccaatctggttgatcctaagcccgtctacaacgatggctacgtctataattggtggagtaccaattaacaactttaa |
46885749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 277 - 330
Target Start/End: Original strand, 46885812 - 46885865
Alignment:
Q |
277 |
gtcggagctcatgaagttttgtccaagactagacaatttttcttgggtcagtta |
330 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
46885812 |
gtcggagctcatgaaattttgtccaagactagacaatttttcttgggtcagtta |
46885865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University