View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0636_high_8 (Length: 360)

Name: NF0636_high_8
Description: NF0636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0636_high_8
NF0636_high_8
[»] chr7 (2 HSPs)
chr7 (30-210)||(46885569-46885749)
chr7 (277-330)||(46885812-46885865)


Alignment Details
Target: chr7 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 30 - 210
Target Start/End: Original strand, 46885569 - 46885749
Alignment:
30 gaatcaagatcatcaacaacaagatgcttataataacatgtatccaccaaccatgatgtatggtgaaccatcttcatccacgaattccacgatgcagcat 129  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||    
46885569 gaatcaagatcatcaacaacaagatgcttataataacatgtatccaccaaccatgacgtatggtgaaccatcttcatccatgaattccacgatgcagcat 46885668  T
130 gactccaatctggttgatcctaagcccatctacaacgatgggtacgtctataattggtggagtaccaattaacaactttaa 210  Q
    ||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||    
46885669 gactccaatctggttgatcctaagcccgtctacaacgatggctacgtctataattggtggagtaccaattaacaactttaa 46885749  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 277 - 330
Target Start/End: Original strand, 46885812 - 46885865
Alignment:
277 gtcggagctcatgaagttttgtccaagactagacaatttttcttgggtcagtta 330  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
46885812 gtcggagctcatgaaattttgtccaagactagacaatttttcttgggtcagtta 46885865  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 2789 times since January 2019
Visitors: 4012