View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0636_low_16 (Length: 310)
Name: NF0636_low_16
Description: NF0636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0636_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 1 - 192
Target Start/End: Complemental strand, 4152746 - 4152555
Alignment:
Q |
1 |
ataattagaggaagatgaagaagaagaaggtgctactaagagcaatagcaaaagcaaaagtggaagaaggaggaaacaaaagaagaatgatcgtggaggt |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4152746 |
ataattagaggaagatgaagaagaagaaggtgctactaagagcaatagcaaaagcaaaagtggaagaaggaggaaacaaaagaagaatgatcgtggaggt |
4152647 |
T |
 |
Q |
101 |
aaagaacctagaaaagaaggcattttcatttttgtgatatagaaaatggaagaagaaaaaagaatgagtttatttgggatatggtactatat |
192 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4152646 |
aaagaacctagaaaagaaggcattttcatttttgtgatatagaaaatggaagaagaaaaaagaatgagtttatttgggatatggtactatat |
4152555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 5 - 168
Target Start/End: Complemental strand, 4159942 - 4159788
Alignment:
Q |
5 |
ttagaggaagatgaagaagaagaaggtgctactaagagcaatagcaaaagcaaaagtggaagaaggaggaaacaaaagaagaatgatcgtggaggtaaag |
104 |
Q |
|
|
|||||||||| ||| |||||||||||||||||||| ||||||||||||| ||||||||||| |||||||||||||||||| |||||| | | || |
|
|
T |
4159942 |
ttagaggaagttgatgaagaagaaggtgctactaatagcaatagcaaaat------tggaagaaggatgaaacaaaagaagaatgagcgtggatgaatag |
4159849 |
T |
 |
Q |
105 |
aacctagaaaagaaggcattttcatttttgtgatatagaaaatggaagaagaaaaaagaatgag |
168 |
Q |
|
|
|||||| || |||||||||||||||||||||| ||| | |||||||||| ||||||||||||| |
|
|
T |
4159848 |
aacctaaaagagaaggcattttcatttttgtgctat-ggaaatggaaga--aaaaaagaatgag |
4159788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University