View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0636_low_23 (Length: 239)
Name: NF0636_low_23
Description: NF0636
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0636_low_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 230
Target Start/End: Original strand, 4152722 - 4152947
Alignment:
| Q |
1 |
ttcttcttcatcttcctctaattatgacaagaaagtaaccatgtcaatctactatgaaagtctatgtcctttttgtgctgattttatagtgaacgatctt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4152722 |
ttcttcttcatcttcctctaattatgacaagaaagtaaccatgtcaatctactatgaaagtctatgtcctttttgtgctgattttatagtgaacgatctt |
4152821 |
T |
|
| Q |
101 |
gtaaggctcttccaaactggtctcatttccattgtggatcttagaatggttccttggggaaatgctgggattaaacctgatggcacttttgattgtcagg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4152822 |
gtaaggctcttccaaactggtctcatttccattgtggatcttagaatggttccttggggaaatgctgggattaaacctgatggcacttttgattgtcagg |
4152921 |
T |
|
| Q |
201 |
tatatatatgttttcattttttatattatt |
230 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4152922 |
----tatatgttttcattttttatattatt |
4152947 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 4159922 - 4160125
Alignment:
| Q |
1 |
ttcttcttcatcttcctctaattatgacaagaaagtaaccatgtcaatctactatgaaagtctatgtcctttttgtgctgattttatagtgaacgatctt |
100 |
Q |
| |
|
|||||| ||| |||||||||| |||| |||||||||||||||||||||||||||||||||||||| |||| || ||||||||| ||||||||| ||||| |
|
|
| T |
4159922 |
ttcttcatcaacttcctctaaaaatgagaagaaagtaaccatgtcaatctactatgaaagtctatgcccttattctgctgatttcatagtgaaccatctt |
4160021 |
T |
|
| Q |
101 |
gtaaggctcttccaaactggtctcatttccattgtggatcttagaatggttccttggggaaatgctgggattaaacctgatggcacttttgattgtcagg |
200 |
Q |
| |
|
|| | |||||| ||||| ||||||||| |||||| |||||| |||||| ||||||||||||||| ||||| | || |||||||||||| |||||||| |
|
|
| T |
4160022 |
gtgaagctctttcaaaccaatctcatttcaattgtgaatcttaaaatggtcccttggggaaatgctaggattgcaactaatggcacttttgtttgtcagg |
4160121 |
T |
|
| Q |
201 |
tata |
204 |
Q |
| |
|
|||| |
|
|
| T |
4160122 |
tata |
4160125 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3265 times since January 2019
Visitors: 4030