View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0637_high_4 (Length: 369)
Name: NF0637_high_4
Description: NF0637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0637_high_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 72; Significance: 1e-32; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 231 - 330
Target Start/End: Complemental strand, 10146888 - 10146789
Alignment:
Q |
231 |
ataattttgaaggactgtattttgcagatatttttaaaaattggaatggaaaaaattgggtgttacttttgtttacttttaactgcagatgtaaataatc |
330 |
Q |
|
|
|||||||||||||||||||||||||||| |||||| ||||||||||||| |||||| |||||| ||||||||| ||||||||||||||||||||||||| |
|
|
T |
10146888 |
ataattttgaaggactgtattttgcagacatttttttaaattggaatggacaaaattaggtgttgcttttgttttcttttaactgcagatgtaaataatc |
10146789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 33 - 94
Target Start/End: Complemental strand, 10147260 - 10147200
Alignment:
Q |
33 |
gagatatcgtttctcttttttctattcacttagttttaatgtgtgtcaattacgggaatata |
94 |
Q |
|
|
|||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10147260 |
gagatatcatttctcttttt-ctattcacttagttttaatgtgtgtcaattacgggaatata |
10147200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 220 - 280
Target Start/End: Complemental strand, 10137767 - 10137708
Alignment:
Q |
220 |
ttgtcaagtggataattttgaaggactgtattttgcagatatttttaaaaattggaatgga |
280 |
Q |
|
|
|||||||||||||||||| |||||||| ||||||||||| |||||| ||||||||||||| |
|
|
T |
10137767 |
ttgtcaagtggataattt-gaaggactatattttgcagacatttttttaaattggaatgga |
10137708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 140 - 206
Target Start/End: Complemental strand, 10146975 - 10146908
Alignment:
Q |
140 |
taatcaaatacttcgatccccatcttc-aacataaaaagctaacgatattagtatcgactgtttggaa |
206 |
Q |
|
|
|||| |||||||||||||||||| ||| |||||||||| ||||||||||| ||| || ||||||||| |
|
|
T |
10146975 |
taattaaatacttcgatccccatgttcaaacataaaaaattaacgatattaatattgagtgtttggaa |
10146908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3009 times since January 2019
Visitors: 4021