View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0637_low_3 (Length: 407)
Name: NF0637_low_3
Description: NF0637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0637_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 2e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 2e-99
Query Start/End: Original strand, 105 - 304
Target Start/End: Complemental strand, 30024925 - 30024726
Alignment:
Q |
105 |
ggtcgagtgagatgaatcaagtggtgggttgtaagagtgcttgttatgcttttaactcacctaagtattgttgcacgggtagttatggaagcccacaggc |
204 |
Q |
|
|
|||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
T |
30024925 |
ggtcaagtgacatgaatcaagtggtgggctgtaagagtgcttgttatgcttttaactcacctgagtattgttgcacgggtagttatggaagcccacaggc |
30024826 |
T |
 |
Q |
205 |
ttgtaagcccactagttattcgagaatctttaagttggcttgccctaaggcttactcttatgcctttgatgatcctacaagtattgttacttgttctatg |
304 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30024825 |
ttgtaagcccactagttattcgagaatctttaagttggcttgccctaaggcttactcttatgcctttgatgatcctacaagtattgttacttgttctatg |
30024726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 125 - 297
Target Start/End: Complemental strand, 45273340 - 45273168
Alignment:
Q |
125 |
gtggtgggttgtaagagtgcttgttatgcttttaactcacctaagtattgttgcacgggtagttatggaagcccacaggcttgtaagcccactagttatt |
224 |
Q |
|
|
||||||||||||| ||||||||| |||||| ||||| |||| |||||| || || |||| | ||| | ||||||| | || ||||||||| ||||| |
|
|
T |
45273340 |
gtggtgggttgtagaagtgcttgtgctgctttcaactctcctaggtattgctgtactggtaactttggtaccccacagacctgcaagcccactgcttatt |
45273241 |
T |
 |
Q |
225 |
cgagaatctttaagttggcttgccctaaggcttactcttatgcctttgatgatcctacaagtattgttacttg |
297 |
Q |
|
|
| |||||||| || |||||||| ||||||||||||||||| | |||||| ||||| ||||||| |||||| |
|
|
T |
45273240 |
caagaatcttcaaaactgcttgcccaaaggcttactcttatgcttatgatgaccctaccagtattgctacttg |
45273168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University