View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0637_low_7 (Length: 325)
Name: NF0637_low_7
Description: NF0637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0637_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 55 - 322
Target Start/End: Original strand, 29392214 - 29392469
Alignment:
Q |
55 |
catctttaagtgagtgcgtgtgttctggtgaggtgccacggctgcaccaagaagaatcacatgagaaatgaaatttaggtaannnnnnngcaaggacaac |
154 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
T |
29392214 |
catctttaagtgagtgcgtgtgttctggtgaggtgccacggctgcaccaagaagaatcacatgagaaatgaaatttaggtaatttttttgcaaggacaac |
29392313 |
T |
 |
Q |
155 |
ccactagcttaattatagataagtttatatgattaaa--atatgtaagtttgataaaatttattatttcatgaacttgcagcattcttttcactagctta |
252 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29392314 |
ccactagcttaattatagataagtttatatgattaaaatatatgtaagtttgataaaatttattatttcatgaacttgcagcattcttttcactagctta |
29392413 |
T |
 |
Q |
253 |
tatcatttttcatatattattttaaatagagtttaagcttaaaattatagcatgtctctttttctctgct |
322 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
29392414 |
tatc--------------attttaaatagagtttaagcttaaaattatagcatgtctctttttctctgct |
29392469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University