View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0637_low_8 (Length: 314)
Name: NF0637_low_8
Description: NF0637
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0637_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 32 - 285
Target Start/End: Complemental strand, 43321881 - 43321630
Alignment:
| Q |
32 |
attattctataattttttggataatgacacgagaccttgaaaataaagtctcacgataatccttaagaattattcatgtcaaatattactaattcannnn |
131 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43321881 |
attattctataattttttggataacgacacgagaccttgaaaataaagtctcacgataatccttaagaattattcatgtcaaatattactaattcatttt |
43321782 |
T |
 |
| Q |
132 |
nnnnagcaagggcgtggtttggttgaatcatcatagcttatatatgataatctttaccaaggcaacaccataaaattttaatttttacacttacacgtgc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43321781 |
ttttagcaagggcgtggtttggttgaatcatcatagcttatatatgataatctttaccaaggcaacaccataaaattttaatttttacacttacacgtgc |
43321682 |
T |
 |
| Q |
232 |
attggatgattagagagcaatcacaattcacaatctatttcattggtaggatag |
285 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43321681 |
attggatgatt--agagcaatcacaattcacaatctatttcattggtaggatag |
43321630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University