View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0638_high_1 (Length: 550)
Name: NF0638_high_1
Description: NF0638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0638_high_1 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 178; Significance: 9e-96; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 178; E-Value: 9e-96
Query Start/End: Original strand, 13 - 284
Target Start/End: Original strand, 4857371 - 4857654
Alignment:
| Q |
13 |
aatatccaagttggaatgtttgacatttatctaggtatgtcaatttgtacatgtaagtggggatctccgtagaaactgccccatttaagccctcgttggc |
112 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |||| |||||||||| ||||||||||||| |
|
|
| T |
4857371 |
aatatccaagttgaaatgtttgacatttatctagggatgtcaatttgtacgtgtaagtggggatctccgtggaaattgccccatttgagccctcgttggc |
4857470 |
T |
|
| Q |
113 |
gagaaggctttcctcacgaggacgagaacaaaagttcaccaactccatagagaccctacct------------ctgaaataacttataaatgttatattt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
4857471 |
gagaaggctttcctcacgaggacgagaacgaaagttcaccaactccatagagaccctacctctaaacagtttactaaaataacttatagatgttatattt |
4857570 |
T |
|
| Q |
201 |
atttgtctttccacacaataagtgtatagatttcttttatatgtnnnnnnntttatttgcacaatactcataatattgtcttgc |
284 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
4857571 |
atttgtctttccacacaataattgtatagatttcttttatatgtaaaaaattttgtttgcacaatactcataatattgtcttgc |
4857654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 145; E-Value: 5e-76
Query Start/End: Original strand, 358 - 521
Target Start/End: Original strand, 4857727 - 4857891
Alignment:
| Q |
358 |
cccccgcaaggaccgtggaaatcgggggtttcggggtcggaaacaggaagaaaatactcctcaaaatagggaatggagacgtggatggagaaaattctgg |
457 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
4857727 |
cccctgcaaggaccgtggaaatcgggggtttcggggtcggaaacaggaagaaaatactcctcaaaatagggaatggagacgtggatggagaaaattttgg |
4857826 |
T |
|
| Q |
458 |
acggcggggatggggagta-cctactccggcgccgtttacatacctagtttatctaagtttattt |
521 |
Q |
| |
|
|| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4857827 |
actgcggggatggggagtaccctactccggcgccgtttacatacctagtttatctaagtttattt |
4857891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3236 times since January 2019
Visitors: 4030