View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0638_low_13 (Length: 255)
Name: NF0638_low_13
Description: NF0638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0638_low_13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 26 - 255
Target Start/End: Complemental strand, 52767470 - 52767237
Alignment:
| Q |
26 |
cctttccctcaaccacccatccctaccacaggtatgtaatgtaatgtaatgttttgtaccctagctagctatacatacata---tataggataagatata |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
52767470 |
cctttccctcaaccacccatccctaccacaggtatgtaatgtaatgtaatgttttgtaccctagctagctatgcatacataatatataggataagatata |
52767371 |
T |
|
| Q |
123 |
gtttttcaataattacaaaatgaatagttaattagattttaatataatatacttt-agtctctcattctttgcttcatgattgatgtatatataggtcca |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52767370 |
gtttttcaataattacaaaatgaatagttaattagattttaatataatatacttttagtctctcattctttgcttcatgattgatgtatatataggtcca |
52767271 |
T |
|
| Q |
222 |
tgaagaattttcagctatacattaatgaaaaaat |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
52767270 |
tgaagaattttcagctatacattaatgaaaaaat |
52767237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 3599 times since January 2019
Visitors: 4038