View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0638_low_14 (Length: 253)

Name: NF0638_low_14
Description: NF0638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0638_low_14
NF0638_low_14
[»] chr6 (1 HSPs)
chr6 (29-253)||(3417510-3417734)


Alignment Details
Target: chr6 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 29 - 253
Target Start/End: Complemental strand, 3417734 - 3417510
Alignment:
29 aatttgaaaggggtaaaaccatgttacaaacaccctccaatacnnnnnnnnnncttttacggattttataatccgaaccaggtgtggacggtgggactgg 128  Q
    ||||||||||||||| ||||||||||||||||||||||||||            |||| ||||||||||||| |||||||||||||||||||||||| ||    
3417734 aatttgaaaggggtataaccatgttacaaacaccctccaatattttttattttttttttcggattttataattcgaaccaggtgtggacggtgggaccgg 3417635  T
129 gaggattcacaagagagagtatatctgaagttgaatccaaggaggaaagtagcatgcaaaaataaaagggcaaaacttccagccttctttgattctttta 228  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||  ||||||||||||    
3417634 gaggattcacaagagagaatatatctgaagttgaatccaaggaggaaagtagcatgcaaaaataaaagggcaaaacttccaacctttgttgattctttta 3417535  T
229 aaaactactcttgtataaattttct 253  Q
    |||||||||| ||||||||||||||    
3417534 aaaactactcctgtataaattttct 3417510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 3540 times since January 2019
Visitors: 4037