View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0638_low_14 (Length: 253)
Name: NF0638_low_14
Description: NF0638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0638_low_14 |
 |  |
|
[»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 29 - 253
Target Start/End: Complemental strand, 3417734 - 3417510
Alignment:
Q |
29 |
aatttgaaaggggtaaaaccatgttacaaacaccctccaatacnnnnnnnnnncttttacggattttataatccgaaccaggtgtggacggtgggactgg |
128 |
Q |
|
|
||||||||||||||| |||||||||||||||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||| || |
|
|
T |
3417734 |
aatttgaaaggggtataaccatgttacaaacaccctccaatattttttattttttttttcggattttataattcgaaccaggtgtggacggtgggaccgg |
3417635 |
T |
 |
Q |
129 |
gaggattcacaagagagagtatatctgaagttgaatccaaggaggaaagtagcatgcaaaaataaaagggcaaaacttccagccttctttgattctttta |
228 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
T |
3417634 |
gaggattcacaagagagaatatatctgaagttgaatccaaggaggaaagtagcatgcaaaaataaaagggcaaaacttccaacctttgttgattctttta |
3417535 |
T |
 |
Q |
229 |
aaaactactcttgtataaattttct |
253 |
Q |
|
|
|||||||||| |||||||||||||| |
|
|
T |
3417534 |
aaaactactcctgtataaattttct |
3417510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University