View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0638_low_15 (Length: 240)
Name: NF0638_low_15
Description: NF0638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0638_low_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 98 - 211
Target Start/End: Original strand, 39931487 - 39931601
Alignment:
| Q |
98 |
gataattattgatcatactttacttaactttcagctaaaatcatgaatactatatgattaagactc-aaacaaaatgattttgatatgtaaaagtgagtg |
196 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| | |||||||||||||| || ||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
39931487 |
gataattactgatcatactttacttaactttcggttaaaatcatgaatattacatgattaagactcaaaacaaaatgattttgatatgtaaaagtgagtg |
39931586 |
T |
 |
| Q |
197 |
aattaataatgtttg |
211 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
39931587 |
aattaataatgtttg |
39931601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 39931196 - 39931292
Alignment:
| Q |
1 |
ttcaacagtataaaattaaatataaacatgcttaattttttgtgtaaatataatatgatccannnnnnnatagtgagaaaaacagtgaaatttacat |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39931196 |
ttcaacagtataaaattaaatataaacatgcttaattttttgtgtaaatataaaatgatccatttttttatagtgagaaaaacagtgaaatttacat |
39931292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University