View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0638_low_15 (Length: 240)

Name: NF0638_low_15
Description: NF0638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0638_low_15
NF0638_low_15
[»] chr2 (2 HSPs)
chr2 (98-211)||(39931487-39931601)
chr2 (1-97)||(39931196-39931292)


Alignment Details
Target: chr2 (Bit Score: 87; Significance: 8e-42; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 98 - 211
Target Start/End: Original strand, 39931487 - 39931601
Alignment:
98 gataattattgatcatactttacttaactttcagctaaaatcatgaatactatatgattaagactc-aaacaaaatgattttgatatgtaaaagtgagtg 196  Q
    |||||||| ||||||||||||||||||||||| | |||||||||||||| || ||||||||||||| |||||||||||||||||||||||||||||||||    
39931487 gataattactgatcatactttacttaactttcggttaaaatcatgaatattacatgattaagactcaaaacaaaatgattttgatatgtaaaagtgagtg 39931586  T
197 aattaataatgtttg 211  Q
    |||||||||||||||    
39931587 aattaataatgtttg 39931601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 1 - 97
Target Start/End: Original strand, 39931196 - 39931292
Alignment:
1 ttcaacagtataaaattaaatataaacatgcttaattttttgtgtaaatataatatgatccannnnnnnatagtgagaaaaacagtgaaatttacat 97  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||       ||||||||||||||||||||||||||||    
39931196 ttcaacagtataaaattaaatataaacatgcttaattttttgtgtaaatataaaatgatccatttttttatagtgagaaaaacagtgaaatttacat 39931292  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University