View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0638_low_20 (Length: 202)

Name: NF0638_low_20
Description: NF0638
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0638_low_20
NF0638_low_20
[»] chr6 (1 HSPs)
chr6 (1-127)||(13034561-13034686)


Alignment Details
Target: chr6 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 1 - 127
Target Start/End: Complemental strand, 13034686 - 13034561
Alignment:
1 agttttgggacatgtacatataannnnnnnngtctaatatcgatcaaatcactatcttagacggtacaatgatttgtgaacttctacttagaagaacggt 100  Q
    |||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
13034686 agttttgggacatgtacatataattttttt-gtctaatatcgatcaaatcactatcttagacggtacaatgatttgtgaacttctacttagaagaacggt 13034588  T
101 gtcggtaattgaataattatattgttg 127  Q
    |||||||||||||||||||||||||||    
13034587 gtcggtaattgaataattatattgttg 13034561  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University